Free
PAIN AND REGIONAL ANESTHESIA  |   July 2007
Nerve Growth Factor Expression after Plantar Incision in the Rat
Author Notes
  • This article is featured in “This Month in Anesthesiology.” Please see this issue of Anesthesiology, page 5A.
    This article is featured in “This Month in Anesthesiology.” Please see this issue of Anesthesiology, page 5A.×
    Received from the Department of Anesthesia, University of Iowa Hospitals and Clinics, Iowa City, Iowa. Submitted for publication September 11, 2006. Accepted for publication February 21, 2007. Supported by the Department of Anesthesia, University of Iowa, and by grant Nos. GM-55831 and GM-067752 (to T.J.B.) from the National Institutes of Health, Bethesda, Maryland.
    Received from the Department of Anesthesia, University of Iowa Hospitals and Clinics, Iowa City, Iowa. Submitted for publication September 11, 2006. Accepted for publication February 21, 2007. Supported by the Department of Anesthesia, University of Iowa, and by grant Nos. GM-55831 and GM-067752 (to T.J.B.) from the National Institutes of Health, Bethesda, Maryland.×
    Address correspondence to Dr. Wu: Department of Anesthesia, 3000 ML, University of Iowa Hospitals and Clinics, Iowa City, Iowa 52242. chaoran-wu@uiowa.edu. This article may be accessed for personal use at no charge through the Journal Web site, www.anesthesiology.org.
    Address correspondence to Dr. Wu: Department of Anesthesia, 3000 ML, University of Iowa Hospitals and Clinics, Iowa City, Iowa 52242. chaoran-wu@uiowa.edu. This article may be accessed for personal use at no charge through the Journal Web site, www.anesthesiology.org.×
Article Information
Central and Peripheral Nervous Systems / Pain Medicine
PAIN AND REGIONAL ANESTHESIA   |   July 2007
Nerve Growth Factor Expression after Plantar Incision in the Rat
Anesthesiology 7 2007, Vol.107, 128-135. doi:10.1097/01.anes.0000267512.08619.bd
Anesthesiology 7 2007, Vol.107, 128-135. doi:10.1097/01.anes.0000267512.08619.bd
Abstract

Background:: Postoperative pain control remains a significant problem. Advances will proceed if we can further reveal the underlying mechanisms of incisional pain and its mediators. Previous studies have demonstrated that nerve growth factor (NGF) is released in incised tissue and contributes to hyperalgesia in incisional pain. The purpose of this study is to examine the expression of NGF in skin after planter incision.

Methods:: Adult Sprague-Dawley rats underwent incision at the plantar aspect of hind paw. The NGF messenger RNA (mRNA) was measured at various times after incision by polymerase chain reaction. NGF protein expression was detected by Western blot and immunohistochemistry in incisions.

Results:: NGF mRNA increased from 2 to 4 h after incision and was the same as control by postoperative day 1. A large-molecular-weight form of NGF, approximately 75 kd, was found in normal skin. The large-molecular-weight NGF protein increased 4 h after incision and returned to baseline on postoperative day 7. The skin immediately adjacent to the incision had the greatest NGF expression. Immunohistochemical staining for NGF was present adjacent to the incision and localized in Schwann cells and axons.

Conclusion:: NGF mRNA is increased and a large-molecular-weight form of NGF protein is expressed in the region adjacent to the incision. NGF immunoreactivity is present in nerve bundles; both Schwann cells and axons are labeled. Immunoreactive NGF in axons is likely taken up into cut axons. This study suggests some common mechanisms for neuropathic and incisional pain.

FOR most patients’ postoperative pain control, opioids are used. These drugs by themselves show incomplete analgesic effects. Local anesthetic injections and perineural infusions can also be used; however, these are for a minority of patients. It will be helpful for developing ideal analgesic drugs and novel therapies if we can further reveal the underlying mechanisms of incisional pain and its mediators. A number of mediators including nerve growth factor (NGF),1 ,2  prostaglandins,3  lactate,4  and acid5  likely contribute to nociceptor sensitization, hyperalgesia, and clinical pain after incision.
Among these factors, close attention has been paid to NGF, which is known as a neurotrophic factor necessary for promotion and survival of nociceptors and the sympathetic nervous system during development.6  In the adult, NGF is considered an important intermediary for the sensitization of nociceptors and induction of inflammation.7  Furthermore, administration of exogenous NGF has been shown to produce hyperalgesia in rats8  and humans,9 ,10  and neutralization of NGF by trkA–immunoglobulin G (IgG) fusion molecule prevents the sensitization of nociceptors in some pain models.11 ,12 
An incision produces an acute increase in NGF levels in skin and we have shown the neutralization of endogenous NGF produces specific antihyperalgesic effects without any acute influence on normal nociceptive responses.1 ,2  The increase in NGF occurs at times that are coincident with its role in pain-related behaviors. In the current study, we examined NGF expression in skin after plantar incision by using quantitative reverse-transcriptase polymerase chain reaction (PCR), Western blot, and immunohistochemistry. We determined which form of NGF is present in normal and incised skin, the changes in NGF protein and messenger RNA (mRNA) at different times after incision, and the distribution and location of NGF after incision.
Materials and Methods
This study was approved by the institutional animal care and use committee at the University of Iowa (Iowa City, Iowa). The rat hind paw plantar incision model was performed in male Sprague-Dawley adult rats weighing 225–300 g as described.13  During anesthesia of 1.5–2.0% halothane, a 1-cm longitudinal incision was made 0.5 cm from the end of heel in the plantar aspect of right hind paw. The underlying flexor muscle was divided, and then the skin was sutured with 5.0 nylon. Antibiotic ointment was applied to the incision immediately after surgery. Sutures were removed on postoperative day (POD) 2. For some rats, a 0.5-cm transverse incision was made 1.0 cm from the end of heel in the right hind paw to examine distal versus proximal NGF expression.
Quantitative Reverse-transcriptase PCR Analysis
Total RNA from incised rat skin tissue samples was prepared according to manufacturer’s instructions using the RNeasy micro kit (cat. No. 74103; Qiagen, Valencia, CA). Some skin samples from sham-incised rat were used as control. The RNA was quantified using Ribogreen reagent (Molecular Probes, Eugene, OR). Two-step reverse-transcriptase PCR was performed on a 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) by using the TaqMan Gold Reverse Transcriptase PCR kit (Applied Biosystems). The RNA was reverse transcribed using random hexamers, and the complementary DNA was amplified using a primer/probe set specific for NGF (RatNGF-fwd: TGACTCCAAGCACTGGAACTCAT, complementary to 693–715 nucleotides in the rat NGF mRNA; RatNGF-rev: GTTTGTCGTCTGTTGTCAACGC, complementary to 947–926 nucleotides in the rat NGF mRNA; RatNGF-Tamra: TGCACCACGACTCACACCTTTGTCA, complementary to 718–742 nucleotides in the rat NGF mRNA). The resulting PCR product was 309 base pairs in length. Thermal cycling was initiated with an initial incubation at 95°C for 10 min. After that, 40 cycles of PCR were performed; each PCR cycle consisted of heating at 95°C for 15 s for melting and at 60°C for 1 min for annealing and extension. The samples were analyzed in triplicate from the reverse-transcription step and normalized to the internal control, a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase. No template samples were used as controls. PCR data were analyzed by ΔΔCt method described in detail by Livak and Schmittgen.14 
Western Blot Analysis
Rats were anesthetized with sodium pentobarbital (150 mg/kg) after sham surgery, or 4 h, day 1, 2, or 7 or 2 weeks after plantar incision. Plantar skin samples were collected and then homogenized and lysed on ice in radioimmunoprecipitation assay buffer containing protease inhibitors. The supernatant was collected by centrifugation, and the protein concentration was quantified by spectrophotometry using the Lowry method.
Twenty micrograms of protein in 20 μl of volume from each sample was electrophoresed on 12% sodium dodecyl sulfate–polyacrylamide gels and then transferred to polyvinylidene difluoride membranes (Bio-Rad Lab, Hercules, CA). The membranes were incubated in rabbit anti-NGF polyclonal antibody15 17  (1:1,000, cat. No. sc-548; Santa Cruz Biotechnology Inc., Santa Cruz, CA) at 4°C overnight, followed by incubation in peroxidase-conjugated donkey anti-rabbit IgG secondary antibody (1:10,000; Jackson ImmunoRes, West Grove, PA) for 4 h. Membranes were then developed with SuperSignal West Femto Maximum Sensitivity Substrate (Pierce Biotechnology Inc., Rockford, IL) and scanned by Kodak Image Station 440 scanner (Eastman Kodak Company, Rochester, NY). After incubating the membranes in stripping buffer at 50°C for 30 min, the membranes were probed for actin as a loading control. Ten nanograms of rat NGF (N2513; Sigma, St. Louis, MO) was also used as a control. The blocking hapten peptide (cat. No. sc-548 P; Santa Cruz Biotechnology Inc.), containing the antigen (100 μg/0.5 ml) used to raise the antibody to rat, mouse, and human NGF, was used to examine the specificity of the anti-NGF antibody. This peptide is within the amino acids 100–150 of human NGF (personal communication, Santa Cruz Biotechnology, May 12, 2006). The intensity of the NGF immunoreactive bands was quantified and normalized with actin bands by Image J software (National Institutes of Health, Bethesda, MD).
Immunohistochemistry
Briefly, rats were anesthetized with sodium pentobarbital (150 mg/kg) and transcardiacally perfused with 0.1 m phosphate-buffered saline, followed by 4% paraformaldehyde. The glabrous plantar skin samples were removed from sham and incised hind paws and postfixed in the same fixative for 4 h. After washing in gradually increasing concentrations of sucrose, samples were rapidly frozen in 2-methylbutane chilled at −80°C. Consecutive sections (10 μm) were prepared and frozen at −80°C until use. NGF expression was visualized by NGF immunohistochemistry using the ABC method. The following antibodies were used: rabbit anti-NGF antibody (1:2,000, cat. No. sc-548; Santa Cruz Biotechnology Inc.) and biotinylated anti-rabbit IgG (1:500; Vector Laboratories, Burlingame, CA). In some cases, consecutive sections underwent NGF immunohistochemistry or hematoxylin and eosin staining to examine the structures with NGF-positive staining. For controls, some sections were processed after preabsorption of the anti-NGF antibody with the blocking peptide (4 pg/μl). Other sections were processed without the primary or the secondary antibody as controls.
Immunofluorescence
Because perineural structures seemed to be immunoreactive in incised skin, we examined the cells that were immunoreactive for NGF protein. Double-labeling confocal microscopy and immunofluorescent staining were performed for NGF and S100 or NGF and protein gene product 9.5 (PGP 9.5). S100, a glial cell marker in central nervous system and a Schwann cell marker in the peripheral nervous system,18  was used to covisualize NGF and Schwann cells. NGF and PGP 9.5 (a panaxonal marker) double labeling were performed to examine the colocalization of NGF and nerve fibers. Endogenous peroxidase was inactivated by incubating the sections of skin from rats on POD 1 with 30% methanol containing 0.1% H2O2 (vol/vol) for 45 min. To block nonspecific reactions, sections were incubated in 0.1 m phosphate-buffered saline containing 1.5% bovine serum albumin, and 0.1% Tween-20 for 1 h. Sections were then processed for NGF and S100 double labeling by using rabbit anti-NGF polyclonal antibody and mouse anti-S100 monoclonal antibody (1:500, cat. No. MAB079-1; Chemicon, Temecula, CA) as the primary antibodies, followed by incubating in Cy3-conjugated goat anti-rabbit IgG (1:200; Jackson ImmunoRes) and Cy2-conjugated goat anti-mouse IgG (1:200; Jackson ImmunoRes). For NGF/PGP 9.5 labeling, the same antibodies were used as described above. Guinea pig anti–PGP 9.5 polyclonal antibody (1:100, cat. No. AB5898; Chemicon) and Cy2-conjugated donkey anti–guinea pig IgG (1:200; Jackson ImmunoRes) were used for axon labeling.
Sections were mounted by DPX and observed under Zeiss 510 confocal microscopy (Carl Zeiss MicroImaging, Inc., Thornwood, NY). Digital images were collected in the LSM 510 software (Carl Zeiss MicroImaging, Inc.). For controls, sections were stained without primary or secondary antibodies; in addition, some sections were processed with a single antibody, NGF, S100, or PGP 9.5.
Nerve growth factor–labeled and NGF/S100 or NGF/PGP 9.5 double-labeled objects within nerve bundles were counted manually using Adobe Photoshop CS software (Adobe Systems Inc., San Jose, CA). The percentage of double-labeled versus NGF immunoreactive objects was obtained. Three random sections from each of three incised rats were studied.
Data Analyses
Data were expressed as mean ± SD. Differences between means were determined by one-way analysis of variance followed by Dunnett post hoc test for comparisons of incision versus sham. P < 0.05 was considered statistically significant.
Results
Reverse-transcriptase PCR Analysis of mRNA Levels for NGF in Incised Hind Paw Skin
Nerve growth factor mRNA increased 16.8 ± 4.4-fold (P < 0.05 vs. sham) at 2 h and 12.0 ± 5.3-fold (P < 0.05 vs. sham) at 4 h after incision compared with sham control skin (fig. 1). The level of NGF mRNA was not significantly increased after POD 1 and was similar to the contralateral nonincised hind paw.
Fig. 1.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
Fig. 1.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
×
Western Blot Analyses of Incised Hind Paw Skin for NGF
Western blot analysis indicated that NGF immunoreactive protein was present in plantar hind paw skin. A representative blot is shown in figure 2A. A large-molecular-weight (MW) form of NGF protein was present in sham-operated skin and incised skin on POD 1 and POD 2. Blots from six rats are shown in figure 2A. The MW was approximately 75 kd. Our antibody detected mature rat NGF, MW approximately 16 kd, which was not present in any skin samples. Incision increased the intensity of expression of the high-MW NGF 4 h later (fig. 2B); the increase was sustained through POD 2 and returned to the basal, unincised level on POD 7. A summary quantifying the NGF immunoreactive bands for different times after incision is shown in figure 2C. NGF protein was increased 4.6 ± 2.9-fold (P < 0.05 vs. sham) at 4 h, 5.7 ± 3.4-fold (P < 0.01 vs. sham) on POD 1, and 3.7 ± 2.5-fold on POD 2 (n = 6 per group) compared with sham-operated skin.
Fig. 2.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
Fig. 2.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
×
The distribution of NGF in incised skin was also examined using Western blot. Samples were taken from two concentric areas surrounding the incision (fig. 3A). Area A was an elliptical region excised from the 1-mm area adjacent to the incision, whereas area B was 1 mm further outside area A. NGF protein increased 4.6 ± 2.4-fold (P < 0.05 vs. sham) on POD 2 in area A. There were no changes of NGF in area B on POD 2 (figs. 3B and C, n = 3 per group). Therefore, the entire increase in protein seemed to come from the area immediately surrounding the incision.
Fig. 3.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
Fig. 3.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
×
Immunohistochemical Analyses of Incised Hind Paw Skin for NGF
Sections of sham, incised and contralateral, unincised skin were collected 4 h after incision, POD 1, POD 2, POD 7, and 2 weeks after incision for NGF immunohistochemistry. There was no NGF immunoreactivity detected in sham-operated, control skin (fig. 4A). NGF immunoreactivity (arrows) was found adjacent to the incision (dashed line) on POD 1 (fig. 4B). A higher magnification of the rectangular area marked in figure 4B is shown in figure 4C. No NGF immunoreactivity was detected surrounding the incision on POD 7 (fig. 4D) or when the antibody was pretreated with the blocking peptide (data not shown).
Fig. 4.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
Fig. 4.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
×
There were no immunoreactive elements in deep, subcutaneous layers in unincised skin (fig. 5A), but NGF-positive staining could be observed in subcutaneous layers after plantar incision (fig. 5B). In this example, most of these NGF immunoreactive elements were localized within apparent nerve-like structures that were adjacent to an artery and vein. Consecutive sections processed for NGF immunohistochemistry and hematoxylin and eosin staining detected NGF-positive staining (fig. 5C, arrows) localized to nerve bundles (fig. 5D, arrows).
Fig. 5.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
Fig. 5.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
×
We hypothesized that Schwann cells or nerve fibers could be staining for NGF. To confirm the location of NGF in incisions, we identified NGF positive staining in incised tissue. Sham control tissue was also examined. Because control tissue did not stain for NGF, we evaluated PGP 9.5–positive and S100-positive regions. In large nerve bundles, there was no NGF-positive labeling (fig. 6A) in normal skin, and Schwann cells were S100 positive (figs. 6B and C, green) in normal skin. In contrast, NGF-positive staining could be found in nerve bundles from incised skin (fig. 6D, red), and some were colocalized with S100 (fig. 6E, green) and thus were Schwann cells (fig. 6F, arrows). From nine sections from three incised rats, 19 ± 11% of NGF-positive objects were colocalized in Schwann cells. Some NGF staining was present in other structures (fig. 6F, arrowheads).
Fig. 6.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
Fig. 6.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
×
Axon staining was examined next. In normal skin, there was no NGF-positive labeling (figs. 7A–C). In incised skin, nine sections from three incised rats showed that 63 ± 11% of NGF-positive objects (fig. 7D, red) were colocalized with PGP 9.5 (fig. 7E, green) and thus were nerve fibers (fig. 7F, arrows).
Fig. 7.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
Fig. 7.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
×
Proximal versus Distal Location of NGF after Incision
We noted that NGF seemed to be present distal to cut axons in incised tissue. After a transverse plantar incision (fig. 8A), NGF-positive staining (arrows) was largely found distal (fig. 8B) but not proximal to the incision (fig. 8C). However, Western blot showed equal (fig. 8D) NGF protein distal (3.8 ± 2.5-fold) and proximal (3.7 ± 2.4-fold) to the transverse incision (fig. 8E, n = 6 per group).
Fig. 8.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
Fig. 8.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
×
Discussion
In this study, we demonstrate that NGF mRNA increases from 2 to 4 h after incision. We found that the high-MW form of NGF protein is normally present in rat skin. This same form increases from 4 h after incision, is maintained for several days, and is normal by POD 7. The increase in large-MW form of NGF is in the area immediately surrounding the incision. In normal skin, immunohistochemistry does not identify NGF-positive structures. After incision, NGF immunoreactive structures are identified; most are adjacent to the incision. Immunoreactive NGF is present in axons; some Schwann cells are labeled. The increase in NGF detected by Western blot and immunohistochemistry coincides with its role in guarding pain and heat hyperalgesia after incision.1 ,2  These findings may be helpful for understanding the function of increased NGF in incised skin and the mechanisms whereby NGF contributes to postoperative pain.
A large-MW form of NGF, approximately a 75-kd species, was consistently detected in all skin samples. Because mature NGF is approximately 16 kd, this large-MW form is likely a glycosylated precursor, like preproNGF, or a dimer of a precursor form as described by others.15 ,19  Our findings are supported by another study showing that a 75-kd form of NGF is present in ovine skin but the mature 16-kd NGF was absent.19  Bierl et al. demonstrated that “mature” forms of the lower-MW NGF proteins are rare in many tissues, large-MW NGF precursors are abundant in peripheral tissues, and each tissue exhibits a characteristic NGF expression pattern.15 ,16  These precursory forms from which mature NGF is cleaved may also be biologically active and contribute to acute pain in this incision model.
Increased NGF mRNA was found in incised skin for 1 day only. NGF mRNA is increased for more than 15 days after major nerve injury.20  The short-lasting increase of NGF mRNA and protein after incision may account for the short duration of acute incisional pain, whereas the long-lasting increase in NGF mRNA after large nerve injury may contribute to a more persistent pain state. This difference in onset and duration of NGF mRNA production may explain some differences between the two pain states.
Nerve growth factor was present in the incised area; the greatest increase was immediately adjacent to the incision. The immunoreactivity was also adjacent to the incision. The innervation of the glabrous skin in the hind paw is largely from the tibial nerve which branches into the plantar nerves. These plantar nerves are large at the malleoli and send branches distal toward the digits. We made a transverse incision in the paw to cut the distal nerve fibers. Immunoreactivity was greatest distal to a transverse incision.
After major nerve injury, NGF is taken up by Schwann cells and axons.21  Intact axons transport the NGF proximally to the dorsal root ganglia, where transcription of a variety of proteins are affected.22  Cut axons and the Schwann cells surrounding cut axons take up NGF.23 ,24  The cut axons do not retrogradely transport NGF, and it is concentrated there. Other studies demonstrate that Schwann cells produced both NGF and the NGF receptor, P75, in the sciatic nerve distal but not proximal to the transection.25 ,26  Therefore, the distribution of immunoreactive NGF in incisions is likely uptake of NGF by Schwann cells and cut axons. Without axonal transport, NGF accumulates in sufficient quantities to be immunoreactive. It is possible that NGF is produced by Schwann cells as well.
Released NGF will be taken up by intact nociceptors and produce peripheral sensitization and hyperalgesia.27  NGF accumulates in injured axons and will contribute to regeneration.28  In addition, NGF can influence expression of a variety of factors in the dorsal root ganglia, some of which are transported to the central nervous system. Both peripheral and central sensitization may occur.29  This mechanism has been proposed for large nerve injury causing persistent neuropathic pain.27 
In summary, NGF mRNA increases for 1 day after plantar incision. A high-MW form of NGF is present and increased at the time NGF contributes to incision-induced pain behavior. NGF immunoreactivity is present in nerve bundles; both Schwann cells and axons are labeled. Immunoreactive NGF in axons is likely uptake into cut axons. This study suggests some common mechanisms for neuropathic and incisional pain.
References
Zahn, PK, Subieta, A, Park, SS, Brennan, TJ Effect of blockade of nerve growth factor and tumor necrosis factor on pain behaviors after plantar incision.. J Pain. (2004). 5 157–63 [Article] [PubMed]
Banik, RK, Subieta, AR, Wu, C, Brennan, TJ Increased nerve growth factor after rat plantar incision contributes to guarding behavior and heat hyperalgesia.. Pain. (2005). 117 68–76 [Article] [PubMed]
Omote, K, Kawamata, T, Nakayama, Y, Kawamata, M, Hazama, K, Namiki, A The effects of peripheral administration of a novel selective antagonist for prostaglandin E receptor subtype EP(1), ONO-8711, in a rat model of postoperative pain.. Anesth Analg. (2001). 92 233–8 [Article] [PubMed]
Kim, TJ, Freml, L, Park, SS, Brennan, TJ Lactate concentrations in incisions indicate ischemic-like conditions may contribute to postoperative pain.. J Pain. (2007). 8 59–66 [Article] [PubMed]
Woo, YC, Park, SS, Subieta, AR, Brennan, TJ Changes in tissue pH and temperature after incision indicate acidosis may contribute to postoperative pain.. Anesthesiology. (2004). 101 468–75 [Article] [PubMed]
Levi-Montalcini, R, Dal Toso, R, della Valle, F, Skaper, SD, Leon, A Update of the NGF saga.. J Neurol Sci. (1995). 130 119–27 [Article] [PubMed]
Julius, D, Basbaum, AI Molecular mechanisms of nociception.. Nature. (2001). 413 203–10 [Article] [PubMed]
Woolf, CJ, Safieh-Garabedian, B, Ma, QP, Crilly, P, Winter, J Nerve growth factor contributes to the generation of inflammatory sensory hypersensitivity.. Neuroscience. (1994). 62 327–31 [Article] [PubMed]
Petty, BG, Cornblath, DR, Adornato, BT, Chaudhry, V, Flexner, C, Wachsman, M, Sinicropi, D, Burton, LE, Peroutka, SJ The effect of systemically administered recombinant human nerve growth factor in healthy human subjects.. Ann Neurol. (1994). 36 244–6 [Article] [PubMed]
Dyck, PJ, Peroutka, S, Rask, C, Burton, E, Baker, MK, Lehman, KA, Gillen, DA, Hokanson, JL, O’Brien, PC Intradermal recombinant human nerve growth factor induces pressure allodynia and lowered heat-pain threshold in humans.. Neurology. (1997). 48 501–5 [Article] [PubMed]
McMahon, SB, Bennett, DL, Priestley, JV, Shelton, DL The biological effects of endogenous nerve growth factor on adult sensory neurons revealed by a trkA-IgG fusion molecule.. Nat Med. (1995). 1 774–80 [Article] [PubMed]
Sevcik, MA, Ghilardi, JR, Peters, CM, Lindsay, TH, Halvorson, KG, Jonas, BM, Kubota, K, Kuskowski, MA, Boustany, L, Shelton, DL, Mantyh, PW Anti-NGF therapy profoundly reduces bone cancer pain and the accompanying increase in markers of peripheral and central sensitization.. Pain. (2005). 115 128–41 [Article] [PubMed]
Brennan, TJ, Vandermeulen, EP, Gebhart, GF Characterization of a rat model of incisional pain.. Pain. (1996). 64 493–501 [Article] [PubMed]
Livak, KJ, Schmittgen, TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method.. Methods. (2001). 25 402–8 [Article] [PubMed]
Bierl, MA, Jones, EE, Crutcher, KA, Isaacson, LG “Mature” nerve growth factor is a minor species in most peripheral tissues.. Neurosci Lett. (2005). 380 133–7 [Article] [PubMed]
Bierl, MA, Isaacson, LG Increased NGF proforms in aged sympathetic neurons and their targets.. Neurobiol Aging. (2007). 28 122–34 [Article] [PubMed]
Bruno, MA, Cuello, AC Activity-dependent release of precursor nerve growth factor, conversion to mature nerve growth factor, and its degradation by a protease cascade.. Proc Natl Acad Sci U S A. (2006). 103 6735–40 [Article] [PubMed]
Gonzalez-Martinez, T, Perez-Pinera, P, Diaz-Esnal, B, Vega, JA S-100 proteins in the human peripheral nervous system.. Microsc Res Tech. (2003). 60 633–8 [Article] [PubMed]
Yardley, G, Relf, B, Lakshmanan, J, Reinshagen, M, Moore, GP Expression of nerve growth factor mRNA and its translation products in the anagen hair follicle.. Exp Dermatol. (2000). 9 283–9 [Article] [PubMed]
Hoke, A, Redett, R, Hameed, H, Jari, R, Zhou, C, Li, ZB, Griffin, JW, Brushart, TM Schwann cells express motor and sensory phenotypes that regulate axon regeneration.. J Neurosci. (2006). 26 9646–55 [Article] [PubMed]
Curtis, R, Tonra, JR, Stark, JL, Adryan, KM, Park, JS, Cliffer, KD, Lindsay, RM, DiStefano, PS Neuronal injury increases retrograde axonal transport of the neurotrophins to spinal sensory neurons and motor neurons via multiple receptor mechanisms.. Mol Cell Neurosci. (1998). 12 105–18 [Article] [PubMed]
Bennett, DL Neurotrophic factors: Important regulators of nociceptive function.. Neuroscientist. (2001). 7 13–7 [Article] [PubMed]
Heumann, R, Korsching, S, Bandtlow, C, Thoenen, H Changes of nerve growth factor synthesis in nonneuronal cells in response to sciatic nerve transection.. J Cell Biol. (1987). 104 1623–31 [Article] [PubMed]
Raivich, G, Hellweg, R, Kreutzberg, GW NGF receptor-mediated reduction in axonal NGF uptake and retrograde transport following sciatic nerve injury and during regeneration.. Neuron. (1991). 7 151–64 [Article] [PubMed]
Johnson, EMJr, Taniuchi, M, DiStefano, PS Expression and possible function of nerve growth factor receptors on Schwann cells.. Trends Neurosci. (1988). 11 299–304 [Article] [PubMed]
Taniuchi, M, Clark, HB, Johnson, EMJr Induction of nerve growth factor receptor in Schwann cells after axotomy.. Proc Natl Acad Sci U S A. (1986). 83 4094–8 [Article] [PubMed]
Ringkamp, M, Meyer, RA Injured versus uninjured afferents: Who is to blame for neuropathic pain?. Anesthesiology. (2005). 103 221–3 [Article] [PubMed]
Heumann, R, Lindholm, D, Bandtlow, C, Meyer, M, Radeke, MJ, Misko, TP, Shooter, E, Thoenen, H Differential regulation of mRNA encoding nerve growth factor and its receptor in rat sciatic nerve during development, degeneration, and regeneration: role of macrophages.. Proc Natl Acad Sci U S A. (1987). 84 8735–9 [Article] [PubMed]
Pezet, S, McMahon, SB Neurotrophins: Mediators and modulators of pain.. Annu Rev Neurosci. (2006). 29 507–38 [Article] [PubMed]
Fig. 1.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
Fig. 1.
Changes in nerve growth factor messenger RNA (mRNA) relative to glyceraldehyde-3-phosphate dehydrogenase mRNA from incised or sham-operated skin. Inc = incised skin; non = contralateral nonincised skin; POD = postoperative day. * P < 0.05 versus sham. n = 6 per group.
×
Fig. 2.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
Fig. 2.
Western blots for nerve growth factor (NGF) immunoreactivity in skin from sham operated and incised rats. (A) Example Western blot using NGF antibody against mature rat NGF (approximately 16 kd) and skin samples from sham-operated and incised rat hind paw skin from six rats. (B) Example of Western blot using a detailed time course after plantar incision. (Top) NGF immunoreactive bands. (Bottom) Immunoreactive actin control bands. (C) Summary of relative changes in NGF protein expression after plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. POD = postoperative day. * P < 0.05, ** P < 0.01 versus sham. n = 6 per group.
×
Fig. 3.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
Fig. 3.
Distribution of nerve growth factor (NGF) in incised skin. (A) Skin samples were collected from area A (1 mm surround the incision) or area B (1 mm outside area A). (B) Western blot of NGF from areas A and B on postoperative day (POD) 2. (C) NGF levels from areas A and B on POD 2 compared with sham-operated skin. * P < 0.05 versus sham. n = 3 per group.
×
Fig. 4.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
Fig. 4.
3′3-Diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in plantar skin. (A) NGF immunohistochemistry in sham-operated skin. (B) NGF (arrows) in dermis adjacent to the incision (dashed line) on postoperative day (POD) 1. (C) A higher magnification of the rectangular area in B. NGF is indicated by the arrows. (D) NGF in incised plantar skin was not evident on POD 7. The arrow indicates the incision. Scale bars: 100 μm for A and B; 50 μm for C; 200 μm for D. Der = dermis; Epi = epidermis.
×
Fig. 5.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
Fig. 5.
Perineural 3′3-diaminobenzidine HCl immunohistochemistry for nerve growth factor (NGF) in a subcutaneous region of plantar skin. (A) In sham-operated skin, a nerve-like structure (n) is shown adjacent to an artery (a) and vein (v). (B) In incised skin, immunoreactivity for NGF within a nerve-like structure on postoperative day 1. The abbreviations, n, a, and v, are the same as A. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF positive nerve-like structures indicated by arrows. (D) Hematoxylin and eosin (H & E) staining of the adjacent consecutive section. Scale bars: 50 μm for A and B; 25 μm for C and D.
×
Fig. 6.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
Fig. 6.
Confocal image of a nerve bundle for nerve growth factor (NGF) and S100 fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) S100 fluorescent immunohistochemistry for Schwann cells (green) in unincised skin. (C) Merged image shows only S100-positive staining in nerve bundle in unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) S100 immunohistochemistry for Schwann cells (green) in incised skin. (F) Merged image of NGF fluorescent (red) and S100 fluorescent (green) immunohistochemistry. Colocalized cells (yellow) are indicated by arrows. Some NGF-positive, S100-negative structures are present (arrowheads). Scale bars: 50 μm for A–C; 10 μm for D–F.
×
Fig. 7.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
Fig. 7.
Confocal image of a nerve bundle for nerve growth factor (NGF) and protein gene product 9.5 (PGP 9.5) fluorescent double-labeling immunohistochemistry. (A) NGF fluorescent immunohistochemistry in unincised skin. (B) PGP 9.5 fluorescent immunohistochemistry for axons (green) in unincised skin. (C) Merged image shows only PGP 9.5–positive staining in nerve bundle from unincised skin. (D) NGF fluorescent immunohistochemistry (red) from nerve bundle in incised skin. (E) PGP 9.5 immunohistochemistry for axons (green) in incised skin. (F) Merged image shows NGF colocalizes with axons (yellow, arrows), whereas some of NGF does not (arrowheads). Scale bars: 20 μm.
×
Fig. 8.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
Fig. 8.
3′3-Diaminobenzidine HCl immunohistochemistry and Western blot for nerve growth factor (NGF) proximal and distal to the incision. (A) Schematic of the plantar hind paw. The solid horizontal line depicts the transverse incision; the broken square represents the skin harvested proximal and distal to the incision. (B) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin distal to the incision. Arrows show NGF-positive immunoreactivity. Epi = epidermis. (C) 3′3-Diaminobenzidine HCl immunohistochemistry for NGF from incised skin proximal to the incision. (D) Example Western blot for NGF protein level in skin samples distal and the proximal to the incision on postoperative day (POD) 2. D = distal; P = proximal. (Top) NGF immunoreactivity. (Bottom) Immunoreactive actin control bands. (E) Summary of relative changes in NGF protein expression proximal and distal to plantar incision. Data are expressed as mean ± SD of ratio of incised skin to sham controls. Scale bars: 25 μm for B; 50 μm for C. * P < 0.05 versus sham. n = 6 per group.
×