Free
Pain Medicine  |   August 2001
Halothane but Not Isoflurane Attenuates Interleukin 1β– induced Nitric Oxide Synthase in Vascular Smooth Muscle
Author Affiliations & Notes
  • Hiroshi Maeda, M.D.
    *
  • Hiroshi Iranami, M.D.
    *
  • Manabu Yamamoto, M.D.
    *
  • Koji Ogawa, M.D.
    *
  • Yoshihiro Morikawa, M.D.
  • Emiko Senba, M.D.
  • Yoshio Hatano, M.D.
    §
  • * Assistant Professor, § Professor and Chair, Department of Anesthesia, † Assistant Professor, ‡ Professor and Chair, 2nd Department of Anatomy.
  • Received from the Department of Anesthesia and 2nd Department of Anatomy, Wakayama Medical College, Wakayama, Japan.
Article Information
Pain Medicine
Pain Medicine   |   August 2001
Halothane but Not Isoflurane Attenuates Interleukin 1β– induced Nitric Oxide Synthase in Vascular Smooth Muscle
Anesthesiology 8 2001, Vol.95, 492-499. doi:
Anesthesiology 8 2001, Vol.95, 492-499. doi:
RECENT studies have implicated cytokines in the pathogenesis of shock caused by bacterial endotoxin. Interleukin 1 (IL-1), a cytokine produced by monocytes or macrophages, causes hypotension and reduced systemic vascular resistance when infused in vivo  . 1 
Nitric oxide (NO) is a multifunctional mediator in the vascular system. Among its most important effects are the inhibitions of vascular tone and of platelet adhesion. 2,3 These effects of NO are mediated by the activation of soluble guanylyl cyclase and the consequent increase in cyclic guanosine monophosphate (cGMP). 4 NO is synthesized from the terminal guanidino nitrogen atom of l-arginine by NO synthase (NOS). 5 There are at least two distinct isoforms of NOS in the vasculature: the constitutively expressed NOS and the inducible NOS (iNOS). 6,7 The former is present in the endothelium and is called endothelial NOS, whereas the latter is induced mainly in vascular smooth muscle (VSM) cells. 6 Once the iNOS is induced, persistent NO synthesis occurs in the VSM, resulting in long-lasting vasodilation.
Both the finding that halothane, a volatile anesthetic, inhibits protein synthesis in liver 8 and lung 9 and the fact that the induction of NOS is inhibited by protein synthesis inhibitors such as cycloheximide, 10 led to a hypothesis that volatile anesthetics might inhibit iNOS induction.
Cyclic adenosine monophosphate (cAMP) can regulate the expression of a number of genes through the conserved cAMP-response element and, more specifically, it plays a major role as a second messenger in IL-1β induction of iNOS mRNA in cultured VSM cells. 11 Furthermore, induction of guanosine triphosphate:cyclohydrolase is controlled by intracellular cAMP. 12 Because volatile anesthetics reportedly have modulatory effects on protein kinase C (PKC), through which cAMP can affect on gene transcription, 13 it is also hypothesized that halothane may affect iNOS induction by acting on the adenylyl cyclase (AC)–cAMP pathway.
Accordingly, this study was designed to examine the effects of halothane and isoflurane on the IL-1β–evoked induction of NOS in the VSM of aortic strips and to determine whether volatile anesthetics affect the induction of iNOS by acting on AC–cAMP pathway.
Materials and Methods
With the approval of the Animal Use Committee of Wakayama Medical College, 103 male Wistar rats weighing 300–400 g were anesthetized with intraperitoneally injected pentobarbital (50 mg/kg). Midline abdominal incisions were followed by exsanguinations via  the abdominal aorta. Each descending thoracic aorta was then removed, cleaned of adherent connective tissue, and cut into rings approximately 3 mm long, which were used for the isometric force measurements, and four longitudinal strips, which were used for the determination of the cGMP and cAMP contents. The endothelium of each ring was removed by gently rubbing the intimal surface with a swab to exclude the possibility of NOS induction by cytokines within the endothelium. 14 The aortic rings were bathed in 10-ml organ baths containing Krebs bicarbonate solution (composition: 119 mm NaCl, 4.7 mm KCl, 1.17 mm MgSO4, 25 mm NaHCO3, 1.18 mm KH2PO4, 2.5 mm CaCl2, and 11 mm glucose), which was gassed with 5% CO2in 95% O2and maintained at 37°C. The Krebs solution contained indomethacin (105m) throughout the experiments to exclude the influences of prostaglandins.
Halothane and isoflurane were introduced into the gas mixture through agent-specific vaporizers (Fluotec 3, Cyprane, Keighley, United Kingdom, for halothane; Fortec, Cyprane, for isoflurane). Their concentrations in the resulting gas mixtures were monitored and adjusted by using an anesthetic agent monitor (model 303, Atom, Tokyo Japan). The concentrations of anesthetics in the bathing solution were measured by gas chromatography as described previously. 15 The concentrations of halothane at 1, 2, and 3% in the bathing solution were 2.93 × 104, 5.87 × 104, and 8.80 × 104m, respectively, and that of isoflurane at 3% was 6.52 × 104m (n = 3).
To keep the experimental system free from lipopolysaccharide, the organ bath and surgical tools were heated at 250°C for 2 h. Heat-labile parts were immersed in 99.9% (vol/vol) ethanol for 12 h. The distilled water used for these experiments was suitable for injection in humans (Otsuka Pharmaceuticals, Tokyo, Japan).
Isometric Force Measurements
Aortic rings were vertically fixed between two parallel tungsten wire hooks. The lower hook was attached to a support leg and the upper one to a force transducer (Nihondenki-sanei Co., Tokyo, Japan). The aortic rings were placed under a resting force of 3.0 g, which had been determined to be optimal in length–tension relation experiments. Isometric contractions and relaxations were recorded and displayed on a polygraph recorder using a force transducer and a carrier amplifier (Type N6682, Nihondenki-sanei Co., Tokyo, Japan). The rings were allowed to equilibrate in the control medium for 90 min, during which the bathing fluid was exchanged every 15 min. After equilibration, rings with and without an intact endothelium were tested for the presence and absence, respectively, of relaxant response to acetylcholine (106m) after precontraction with phenylephrine (3 × 107m). Contractile responses to phenylephrine and KCl (30 mm) were obtained twice, before and after the exposure to test agents. Contractile responses of second trial were expressed as a percentage relative to the maximal responses (phenylephrine, 105m; KCl, 30 mm) of the first trial. Phenylephrine and KCl were used as constrictors for the purpose of demonstrating that the effects of agents used in the study are not specific to one contractile mechanism.
In the preliminary study, IL-1β exposure (20 ng/ml) for 1, 3, 5, and 7 h inhibited the maximal contraction caused by phenylephrine (105m) in a time-dependent manner: the mean percentage contractions relative to that before exposure to IL-1β were 106.5 ± 5.8%, 81.0 ± 8.1%, 66.3 ± 7.1%, and 63.9 ± 9.2%, respectively (n = 5 each). The contractions were significantly reduced with time, but there was no significant difference between the contractions observed after 5- and 7-h exposures. Thus, in the subsequent experiment, rat aortic rings were exposed to IL-1β for 5 h.
Effects of Volatile Anesthetics on Contractile Responses
The contractile response to KCl (30 mm) and the dose–contractile response relation for phenylephrine were obtained for each aortic ring before exposure to test agents. To determine the effects of halothane or isoflurane on IL-1β–induced inhibition of the contractile response, three to five rings obtained from the same rat were randomly tested during each condition: (1) control (without any test agent); (2) IL-1β (20 ng/ml) plus halothane (1, 2, or 3); (3) IL-1β (20 ng/ml) plus isoflurane (3%); (4) IL-1β (20 ng/ml) alone; (5) halothane (3%) alone; (6) isoflurane (3%) alone; and (7) IL-1β (20 ng/ml) plus a recombinant human IL-1 receptor antagonist (103m). The rings of the control group were left unexposed to any test agent for 5 h. After exposure to IL-1β or an anesthetic, the aortic rings were repeatedly washed with fresh bathing fluid for at least 30 min before the response to KCl and phenylephrine was obtained again. After the second response to phenylephrine had leveled off, N  G-l-nitro-arginine (final concentration, 3 × 105m) was added to the bath.
Radioimmunoassay for Cyclic Guanosine Monophosphate and Cyclic Adenosine Monophosphate
Four longitudinal aortic strips from each rat were suspended in organ baths, not under tension, and allowed to equilibrate for 90 min. One of the four strips was not exposed to any of the test agents (control), and the remaining three strips were exposed to IL-1β alone, halothane alone, or IL-1β plus halothane for 5 h.
The strips were then repeatedly washed with fresh fluid for 30 min, quick-frozen in liquid nitrogen, homogenized in 6% volume-to-volume ratio trichloroacetic acid, and subjected to ether extraction and succinylation. The cGMP and cAMP in each sample were measured using a commercial radioimmunoassay kit (125I kit;Yamasa, Chiba, Japan). The strips used for the time-course measurement were frozen quickly in liquid nitrogen after exposure to agents for 0, 1, 3, or 5 h, then the cGMP and cAMP contents were measured in a same method as described previously. All rings were treated with indomethacin (105m) throughout the experiments.
Northern Blot Hybridization
To prepare the cDNA probe, the total RNA (2 μg) from the aorta isolated from a rat treated with lipopolysaccharide (0555:B5, Sigma Chemical, St. Louis, MO; 20 mg/kg) for 4 h was reverse-transcribed by incubation with 1 μm oligo(dT)15 primer, 3 mm MgCl, 400 U murine Moloney leukemia virus reverse transcriptase, 500 μm dNTP, 0.01 mm dithiothreitol, 75 mm KCl, and 50 mm Tris-HCl, pH 8.3, in a final volume of 20 μl at 37°C for 1 h.
Polymerase chain reaction primers for rat iNOS were synthesized according to the oligonucleotide sequences corresponding to amino acid residues 944–951 and 1130–1136: GATCAATAACCTGAAGCCCG and GCCCTTTTTTGCTCCATAGG. 16 The cDNA was amplified by 40 cycles of polymerase chain reaction in a 40-μl reaction volume containing reverse-transcribed cDNA generated from 100 ng of total RNA, 1.25 U of Taq DNA polymerase, and each primer at 0.5 μm denaturing at 94°C for 1 min, annealing at 60°C for 1.5 min, and extension at 72°C for 2 min. The polymerase chain reaction product of the expected size (577 bp) was used as a cDNA probe for iNOS.
Total RNA for Northern blot hybridization was prepared from aortic strips that were exposed to (1) IL-1β (20 ng/ml), (2) IL-1β (20 ng/ml) plus halothane (3%), or (3) no test agent (control) for 5 h by the acid phenol method. 17 Samples of 20 μg total RNA were fractionated on a 1.2% agarose gel and transfered to a nylon membrane (Hybond N, Amersham Co., Tokyo, Japan). The cDNA probes for rat iNOS and human 18S ribosomal RNA were labelled with dCTP by nick translation or random-primer labeling, respectively. Hybridization was conducted for approximately 48 h at 42°C. The membrane was washed under high stringency conditions (2 × 15 min with 4 × sodium citrate–sodium chloride buffer [SSC] at room temperature and 1 × 60 min with 0.3 × SSC, 0.1% sodium dodecyl sulphate at 52°C), the radioactivity was measured by an imaging analyzer (BAS2000; Fuji Photo Film Co. Ltd. Tokyo, Japan), and the relative content of iNOS mRNA to ribosomal RNA was calculated.
To determine whether the effect of halothane on iNOS mRNA expression is specific, inducible-type cyclooxygenase (cyclooxygenase 2 [COX-2]) mRNA was investigated by means of Northern blot hybridization with regard to the effect of halothane on COX-2 mRNA expression. Probes used for Northern analysis were a 1 kb 3′ end rat COX-2 cDNA. Northern blot analysis was conducted as previously described, and the radioactivity was then measured by an imaging analyzer, and the relative content of COX-2 mRNA to β actin was calculated.
Western Blotting
The protein fractions of homogenates from aortic tissues that were exposed to (1) IL-1β (20 ng/ml), (2) IL-1β (20 ng/ml) plus halothane (3%), or (3) no test agent (control) for 5 h were separated on denatuturing 7.5% polyacrylamide gels, followed by blotting onto polyvinilidene difluoride membranes. The subsequent steps were performed using a commercial kit according to the manufacturer’s instructions (Kirkegaard & Perry Laboratories, Inc., Gaithersburg, MD). The antibody used in this experiment was anti-macNOS pAb (Transduction Laboratories, Lexington, KY). Signals were visualized by the horseradish peroxidase–tetramethylbenzidine reaction. These signals were measured by imaging analyzer. Then the density was expressed as a percentage relative to that of the IL-1β group.
Data Analysis
The magnitude of the contractions observed after exposure to IL-1β or the test agents were expressed as a percentage relative to the maximal contraction (phenylephrine, 105m; KCl, 30 mm) that was obtained before the exposure. The data are expressed as mean ± SEM. Data from the study were evaluated by analysis of variance for repeated measurements follower by the Scheffé F test. Responses that differed from control values at P  < 0.05 were considered statistically significant. All statistical analyses were performed using Statview II (Abacus Concepts, Inc., Berkeley, CA) on an Apple Macintosh computer (Apple Computer, Inc., Cupertino, CA). In this study, n represents the number of animals, not rings.
Drugs
All drugs used in this study were obtained from Sigma Chemical Co. (St. Louis, MO) unless specified as follows. Human recombinant IL-1β was gift from Otsuka Pharmaceuticals (Tokushima, Japan). Human IL-1 receptor antagonist, halothane, and isoflurane were obtained from R & D Systems Inc. (Minneapolis, MN), Hoechst Japan Limited (Osaka, Japan), and Dainabot (Osaka, Japan), respectively. Indomethacin was dissolved in 99% vol/vol ethanol, and all other chemicals were dissolved in distilled water.
Results
Effects of Interleukin 1β Exposure on Vascular Contractility
Exposure of aortic rings without endothelium to IL-1β for 5 h significantly attenuated the contractile responses to phenylephrine and KCl, and the dose–contractile response curve for phenylephrine was shifted to the right and downward (fig. 1). The maximal contraction caused by phenylephrine (final concentration, 105m) was significantly reduced from 2,823 ± 182 to 1,784 ± 367 mg (fig. 1A; n = 7;P  < 0.01). EC50in the IL-1β groups (2.7 ± 1.2 × 107m) was higher (P  < 0.01) than that in control (1.7 ± 1.1 × 108m). The addition of N  G-l-nitro-arginine (final concentration, 3 × 105m) completely restored the contractions in response to phenylephrine that had been inhibited by previous IL-1β exposure (fig. 1A).
Fig. 1. (A  ) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G  ) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P  < 0.01). EC50in the control group was less than that in the IL-1β group (P  < 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P  < 0.05). n = 7 rings each. (B  ) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P  < 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P  < 0.05). n = 7 rings each. For further details, see text.
Fig. 1. (A 
	) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J 
	), exposed to interleukin (IL)-1β (20 ng/ml, E 
	), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G 
	) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P 
	< 0.01). EC50in the control group was less than that in the IL-1β group (P 
	< 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P 
	< 0.05). n = 7 rings each. (B 
	) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P 
	< 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P 
	< 0.05). n = 7 rings each. For further details, see text.
Fig. 1. (A  ) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G  ) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P  < 0.01). EC50in the control group was less than that in the IL-1β group (P  < 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P  < 0.05). n = 7 rings each. (B  ) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P  < 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P  < 0.05). n = 7 rings each. For further details, see text.
×
Contractions caused by 30 mm KCl were also significantly reduced from 112.7 ± 5.4 to 38.8 ± 6.1% (fig. 2; n = 7;P  < 0.01). IL-1β exposure attenuated the contractile responses evoked by both phenylephrine and KCl, suggesting that the effects of IL-β on contractility were independent on contractile mechanism.
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A  ), interleukin (IL)-1β (20 ng/ml) alone (B  ), HAL (1%) plus IL-1β (20 ng/ml) (C  ), HAL (2%) plus IL-1β (20 ng/ml) (D  ), and HAL (3%) plus IL-1β (20 ng/ml) (E  ) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A  ), IL-1β alone (B  ), HAL (1%) plus IL-1β (C  ), HAL (2%) plus IL-1β (D  ), and HAL (3%) plus IL-1β (E  ) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P  < 0.05 versus  IL-1β; †P  < 0.01 versus  control. n = 7 rings each. For further details, see text.
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A 
	), interleukin (IL)-1β (20 ng/ml) alone (B 
	), HAL (1%) plus IL-1β (20 ng/ml) (C 
	), HAL (2%) plus IL-1β (20 ng/ml) (D 
	), and HAL (3%) plus IL-1β (20 ng/ml) (E 
	) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A 
	), IL-1β alone (B 
	), HAL (1%) plus IL-1β (C 
	), HAL (2%) plus IL-1β (D 
	), and HAL (3%) plus IL-1β (E 
	) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P 
	< 0.05 versus 
	IL-1β; †P 
	< 0.01 versus 
	control. n = 7 rings each. For further details, see text.
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A  ), interleukin (IL)-1β (20 ng/ml) alone (B  ), HAL (1%) plus IL-1β (20 ng/ml) (C  ), HAL (2%) plus IL-1β (20 ng/ml) (D  ), and HAL (3%) plus IL-1β (20 ng/ml) (E  ) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A  ), IL-1β alone (B  ), HAL (1%) plus IL-1β (C  ), HAL (2%) plus IL-1β (D  ), and HAL (3%) plus IL-1β (E  ) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P  < 0.05 versus  IL-1β; †P  < 0.01 versus  control. n = 7 rings each. For further details, see text.
×
Exposure to IL-1β and a recombinant human IL-1 receptor antagonist (10 μg/ml) completely abolished the IL-1β–induced inhibition of contractile responses to phenylephrine (n = 3).
Effects of Volatile Anesthetics on Interleukin 1β–induced Inhibition of Contraction
The contractions caused by phenylephrine and KCl after the rings had been exposed to halothane (3%) or isoflurane (3%) alone for 5 h were comparable to those of the control rings, which had not been exposed to any test agents. Simultaneous exposure to halothane (1.0–3.0%) plus IL-1β (20 ng/ml) significantly reduced the IL-1β–induced inhibition of the contractile response to phenylephrine in a concentration-dependent manner (fig. 1). The addition of N  G-l-nitro-arginine (3 × 105m) did not affect the contractions of the control rings or of rings that had been exposed to halothane or isoflurane but not IL-1β. The IL-1β–induced inhibition of contraction caused by 30 mm KCl was also significantly reduced by simultaneous exposure to halothane (1.0–3.0%;fig. 2;P  < 0.05; n = 7).
Simultaneous exposure to isoflurane (3.0%) and IL-1β (20 ng/ml) had no effect on the IL-1β–induced inhibition of the contractile response to phenylephrine (fig. 3; n = 7).
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B  ) for 5 h. Contractions induced by PE (105m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J 
	), exposed to interleukin (IL)-1β (20 ng/ml, E 
	), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B 
	) for 5 h. Contractions induced by PE (10−5m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B  ) for 5 h. Contractions induced by PE (105m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
×
Effects of Interleukin 1β and Halothane on the Cyclic Guanosine Monophosphate and Cyclic Adenosine Monophosphate Contents of Vascular Smooth Muscle
Exposure of the endothelium-denuded rat aorta to IL-1β (20 ng/ml) for 5 h caused an increase in the tissue cGMP contents in an exposure time–dependent manner. The concentrations of cGMP measured in aortic strips that were exposed to halothane plus IL-1β were significantly lower than those of strips exposed to IL-1β alone (fig. 4A). Exposure of endothelium-denuded rat aorta to halothane alone had no effects on the cGMP contents during the exposing period (fig. 4B).
Fig. 4. (A  ) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P  < 0.01 versus  control; #P  < 0.01 versus  IL-1β; n = 6 strips each. (B  ) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C  ) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P  < 0.05 versus  control 5 h.
Fig. 4. (A 
	) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P 
	< 0.01 versus 
	control; #P 
	< 0.01 versus 
	IL-1β; n = 6 strips each. (B 
	) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C 
	) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P 
	< 0.05 versus 
	control 5 h.
Fig. 4. (A  ) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P  < 0.01 versus  control; #P  < 0.01 versus  IL-1β; n = 6 strips each. (B  ) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C  ) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P  < 0.05 versus  control 5 h.
×
The cAMP contents of the IL-1β (20 ng/ml) group were slightly higher than those of control. The cAMP contents of the IL-1β (20 ng/ml) plus halothane (3%) group were almost same as those of the IL-1β group. Exposure to halothane (3%) did not alter the cAMP accumulation during the exposure period (1, 3, and 5 h;fig. 4C).
Northern Blot Hybridization Analysis: Effects of Interleukin 1β and Halothane on the mRNA expression of Induced Nitric Oxide Synthase and Cyclooxygenase-2
Northern blot hybridization using the synthesized cDNA probes for rat iNOS showed a single band corresponding to the size of iNOS mRNA (approximately 4.4 kb, fig. 5). No hybridization signal for iNOS mRNA was observed in the control aortae by Northern blot hybridization. Exposure to IL-1β for 5 h induced the expression of iNOS mRNA. Exposure to IL-1β in combination with halothane attenuated the expression of iNOS mRNA.
Fig. 5. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B  ) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 6 each. HAL = halothane.
Fig. 5. (A 
	) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B 
	) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P 
	< 0.01 versus 
	control; #P 
	< 0.05 versus 
	interleukin (IL)-1β; n = 6 each. HAL = halothane.
Fig. 5. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B  ) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 6 each. HAL = halothane.
×
Northern blot hybridization using the synthesized cDNA probes for rat COX-2 showed a single band corresponding to the size of COX-2 mRNA (approximately 1 kb;fig. 6). Halothane inhibited the COX-2 mRNA expression that was evoked by IL-1β.
Fig. 6. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B  ) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 4 each. HAL = halothane.
Fig. 6. (A 
	) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B 
	) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P 
	< 0.01 versus 
	control; #P 
	< 0.05 versus 
	interleukin (IL)-1β; n = 4 each. HAL = halothane.
Fig. 6. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B  ) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 4 each. HAL = halothane.
×
Western Blot Analysis: Effects of Interleukin 1β and Halothane on the Expression of Induced Nitric Oxide Synthase Protein
The antiserum reacted exclusively with a protein band corresponding to approximately 130 kd in homogenates of rat aortic tissue treated with IL-1β alone. The signal produced after stimulation of the rat aorta with IL-1β plus halothane was greatly attenuated compared with that produced when stimulated with IL-1β alone. No band was detected in homogenates from nonstimulated tissues (fig. 7).
Fig. 7. (A  ) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B  ) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P  < 0.05 versus  IL-1β; n = 4 each.
Fig. 7. (A 
	) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B 
	) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P 
	< 0.05 versus 
	IL-1β; n = 4 each.
Fig. 7. (A  ) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B  ) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P  < 0.05 versus  IL-1β; n = 4 each.
×
Discussion
The current study has demonstrated that the exposing of rat aortic rings without endothelium to IL-1β for 5 h results in hyporesponsiveness to vasoactive agents (phenylephrine and KCl) in association with an increase in the tissue cGMP content and increased the expression of iNOS mRNA and iNOS protein, in agreement with previous reports. 4,18 These results suggest that hyporesponsiveness, independent on the difference in the contraction mechanism, was a consequence of IL-1β–induced iNOS expression after the accumulation of cGMP content. The current study has also clearly demonstrated that halothane, but not isoflurane, significantly inhibited the vascular response induced by IL-1β. Halothane also suppressed the accumulation of cGMP content and the expression of iNOS mRNA and iNOS protein induced by IL-1β in rat vascular smooth muscle. In addition, IL-1β also caused the increase of the expression of COX-2 mRNA in rat VSM, and halothane suppressed this expression, suggesting that the effect of halothane on mRNA expression is not specific for iNOS.
The effects of volatile anesthetics, including halothane and isoflurane, on vasorelaxation mediated via  the NO–cGMP pathway have been the subjects of several investigations recently. Several mechanisms by which halothane may inhibit acetylcholine- or bradykinin-induced vasorelaxation mediated via  endothelium-derived NO have been proposed. 19 In the current study, these sites of action are not involved in halothane-induced inhibition, because the endothelium was removed from the aortic rings. On the other hand, halothane reportedly induces vasorelaxation, which is mediated via  an increase in the tissue cGMP content. Halothane at concentrations more than 2.0% has been shown to increase the cGMP content of isolated rat aorta 20 and of dog middle cerebral artery. 21 However, this effect of halothane was not observed in the current study, in which halothane antagonized the IL-1β–induced increase in the cGMP content.
In addition to acting on the endothelium, several reports have suggested that halothane affects the soluble guanylyl cyclase within the VSM. Hart et al.  22 demonstrated that halothane inhibits the soluble guanylyl cyclase that is present in VSM and catalyzes the formation of cGMP from guanosine triphosphate. Although the inhibitory effect of halothane on IL-1β–induced hyporesponsiveness might be a result of this effect of halothane on soluble guanyly cyclase, in our study the contractile responses to phenylephrine or KCl of aortic rings exposed to halothane alone were comparable to that of the control rings, and exposure to halothane alone had no effect on cGMP content. Thus, it is unlikely that the inhibitory effect of halothane on the IL-1β–induced hyporesponsiveness of the VSM and the increase in the cGMP content may be a result of its inhibitory action on the soluble guanylyl cyclase activity of VSM. It is suggested that the inhibitory effect of halothane on the expression of iNOS mRNA and iNOS protein may cause the following inhibition of IL-1β–induced hyporesponsiveness.
It has been reported that cAMP plays a major role as a second messenger in the IL-1β–evoked induction of iNOS mRNA in cultured VSM cells. 11 Activation of IL-1 receptor leads to stimulation of AC, with subsequent activation of cAMP–protein kinase A pathway. The stimulative effect of cAMP on iNOS induction in VSM cells could occur at the level of nuclear factor κB and guanosine triphosphate:cyclohydrolase activity. IL-1β can also cause COX-2 induction and after the increase of cAMP content. Because our cyclic nucleotides measurements were performed in the presence of indomethacin, cAMP contents measured in this study were not consequences of induction of COX-2. Our cyclic nucleotides measurements revealed that IL-1β increased cAMP contents in VSM of rat aortic tissues. Furthermore, simultaneous exposure to IL-1β plus forskolin (an AC stimulator) enhanced the IL-1β–induced inhibition of the contractile response of the aortic rings to phenylephrine, and exposure to IL-1β plus 2′,3′-dideoxyadenosine (an AC inhibitor) attenuated the IL-1β–induced inhibition (data not shown). From these findings, it is suggested that cAMP might contribute to iNOS induction evoked by IL-1β even in the VSM of rat aortic tissues.
There has been no report that halothane affects the accumulation of cAMP contents induced by IL-1β in VSM cells of rat aortic tissues. In the current study, cAMP contents of aortic tissues exposed to halothane alone were similar to those of control group during the exposure period. Furthermore, cAMP contents of the halothane plus IL-1β group were also similar to those of the IL-1β group. These results suggest that halothane might not have any effects on the cAMP accumulation in the VSM cells of rat aortic tissues. Thus, it is unlikely that halothane interferes with the iNOS induction by inhibiting the pathway through which AC–cAMP was associated.
Although the mechanism by which halothane down-regulates iNOS expression remains unknown, it may be mediated through the alteration in the rate of transcription or stability of iNOS mRNA. In the promoter region of iNOS, PKC responsive cis  elements, such as binding site of nuclear factor κB, which is activated either by direct phosphorylation or by the phosphorylation of associated regulatory proteins, are present. Activation of PKC has been reported to be of no consequence, 18 to up-regulate, 23 or to down-regulate 24 the cytokine-induced increase in iNOS gene expression in VSM cells. Halothane has been shown to activate PKC 25; therefore, if PKC down-regulates the cytokine-induced increase in iNOS gene expression, this may be one candidate for the mechanism by which halothane down-regulates iNOS gene expression.
Zuo and Johns 26 have reported that halothane and isoflurane, at final concentrations of 2%, up-regulate the iNOS expression stimulated by lipopolysaccharide in cultured macrophages. Otherwise, our Northern blot hybridization experiment revealed that halothane significantly inhibited the iNOS mRNA expression induced by IL-1β. The reasons for these differences between our results and those of Zuo and Johns are not apparent; however, differences concerning iNOS induction between cultured cells and VSM tissues may explain this discrepancy. It has been reported that cycloheximide, a protein synthesis inhibitor, up-regulates iNOS mRNA expression evoked by lipopolysaccharide plus interferon γ in cultured VSM cells, whereas in VSM tissues cycloheximide attenuates the induction. 27 The cycloheximide-dependent induction has also been demonstrated in mouse peritoneal macrophages. 28 This indicates that the induction of iNOS mRNA in VSM tissues requires de novo  protein synthesis, proteins or transcription factors that seems to be constitutively expressed in VSM cells in culture. Furthermore, in this study, halothane suppressed COX-2 mRNA expression, which was similar to the effect of halothane on iNOS mRNA expression, suggesting that the effects of halothane on mRNA may not be specific to iNOS. From our results, together with those of Zuo and Johns 26 and concomitant reports concerning cycloheximide, the effect of halothane on mRNA expression appears to be similar to those of cycloheximide as a protein synthesis inhibitor. In addition, Ghantous et al.  8 demonstrated that halothane inhibits protein synthesis in guinea pig liver slices. This protein synthesis inhibitor-like effect of halothane might be one of the possible mechanisms for these mRNA suppressions. Further studies will determine the exact site of action or mechanism of halothane in the mRNA expression pathway.
In the current study, isoflurane failed to affect the IL-1β–induced hyporesponsiveness to contractile agents, which was contrary to the effects of halothane. The vascular effects of volatile anesthetics have been demonstrated to vary depending on the anesthetics used. Halothane in vivo  does not change systemic vascular resistance, whereas isoflurane and sevoflurane decrease it. 29 In addition, the in vitro  effects of these anesthetics on isolated vascular preparations differ from each other. Halothane relaxes isolated porcine coronary artery to a greater degree than isoflurane. 30 It has been demonstrated that isoflurane is also capable of inhibiting protein synthesis in guinea pig liver slices, but to a lesser extent than halothane. 9 Assuming that the effects of halothane on iNOS might be caused by protein synthesis inhibition, it is not surprising that isoflurane failed to affect the IL-1β–induced hyporesponsiveness, since even halothane, which seems to be more potent in the protein synthesis inhibition than isoflurane, partially reversed the hyporesponsiveness.
In summary, we demonstrated that halothane suppressed the expression of iNOS mRNA and iNOS protein, then inhibited the hyporesponsiveness to vasoactive agents in association with an increase in the tissue cGMP content evoked by IL-1β exposure in VSM tissues. These results suggest that halothane affects the physiologic reaction mediated by the NO-signaling pathway. Determining the mechanism underlying halothane’s inhibition of iNOS pathway would provide the contribution for understanding the mechanisms of inhalational anesthetics, which remain unclear even in the clinical situation.
References
Dinarello CA, Okusawa S, Gelfand JA: Interleukin-1 induces a shock-like state in rabbits: Synergism with tumor necrosis factor and the effect of ibuprofen. Prog Clin Biol Res 1989; 299: 203–15Dinarello, CA Okusawa, S Gelfand, JA
Bhardwaj R, Moore PK: The effect of arginine and nitric oxide on resistance blood vessels of the perfused rst kidney. Br J Pharmacol 1989; 97: 739–44Bhardwaj, R Moore, PK
Radomski MW, Palmer RM, Moncada S: Endogenous nitric oxide inhibits human platelet adhesion to vascular endothelium. Lancet 1987; 2: 1057–8Radomski, MW Palmer, RM Moncada, S
Mellion BT, Ignarro LJ, Ohlstein EH, Pontecorvo EG, Hyman AL, Kadowitz PJ: Evidence for the inhibitory role of guanosine 3’, 5’-monophosphate in ADP induced human platelet aggregation in the presence of nitric oxide and related vasodilators. Blood 1981; 57: 946–55Mellion, BT Ignarro, LJ Ohlstein, EH Pontecorvo, EG Hyman, AL Kadowitz, PJ
Palmer RM, Ashton DS, Moncada S: Vascular endothelial cells synthesize nitric oxide from L-arginine. Nature 1988; 333: 664–6Palmer, RM Ashton, DS Moncada, S
Radomski MW, Palmar RM, Moncada S: Glucocorticoids inhibit the the expression of an inducible, but not constitutive nitric oxide synthase in vascular endothelial cells. Proc Natl Acad Sci U S A 1990; 87: 10043–7Radomski, MW Palmar, RM Moncada, S
Busse R, Mulsch A: Induction of nitric oxide synthase by cytokines in vascular smooth muscle cells. FEBS Lett 1990; 275: 87–90Busse, R Mulsch, A
Ghantous HN, Fernando JL, Keith RL, Gandolfi AJ, Brendel K: Effects of halothane and other volatile anesthetics on protein synthesis and secretion in guineapig liver slices. Br J Anesth 1992; 68: 172–9Ghantous, HN Fernando, JL Keith, RL Gandolfi, AJ Brendel, K
Heys SD, Norton AC, Dundas CR, Eremin O, Ferguson K, Garlick PJ: Anaesthetic agents and their effect on tissue protein synthesis in the rat. Clin Sci 1989; 77: 651–5Heys, SD Norton, AC Dundas, CR Eremin, O Ferguson, K Garlick, PJ
Marczin N, Go CY, Papapetropoulos A, Catravas JD: Induction of nitric oxide synthase by protein synthesis inhibition in aortic smooth muscle cells. Br J Pharmacol 1998; 123: 1000–8Marczin, N Go, CY Papapetropoulos, A Catravas, JD
Imai T, Hirata Y, Kanno K, Marumo F: Induction of nitric oxide synthase by cyclic AMP in rat vascular smooth muscle. J Clin Invest 1994; 93: 543–9Imai, T Hirata, Y Kanno, K Marumo, F
Shen RS, Zhang YX, Perez-Polo JR: Regulation of GTP cyclohydrolase I and dihydropteridine reductase in rat pheochromocytoma PC 12 cells. J Enzyme Inhibition 1989; 3: 119–26Shen, RS Zhang, YX Perez-Polo, JR
Hemmings HC Jr, Adamo ALB: Effects of halothane and propofol on purified brain protein kinase C activation. A nesthesiology 1994; 81: 147–55Hemmings, HC Adamo, ALB
Bereta J, Bereta M, Allison AC, Kruger PB, Koj A: Inhibitory effect of di-catechol rooperol on VCAM-1 and iNOS expression in cytokine-stimulated endothelium. Life Sciences 1997; 60: 325–34Bereta, J Bereta, M Allison, AC Kruger, PB Koj, A
Renzi F, Waud BE: Partition coefficient of volatile anesthetics in Kreb’s solution. A nesthesiology 1977; 47: 62–3Renzi, F Waud, BE
Nunokawa Y, Ishida N, Tanaka S: Cloning of inducible nitric oxide synthase in rat vascular smooth muscle cells. Biochem Biophys Res Commun 1993; 191: 89–94Nunokawa, Y Ishida, N Tanaka, S
Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987; 162: 156–9Chomczynski, P Sacchi, N
Kanno K, Hirata Y, Imai T, Marumo F: Induction of nitric oxide synthase gene by interleukin in vascular smooth muscle cells. Hypertension 1993; 22: 34–9Kanno, K Hirata, Y Imai, T Marumo, F
Johns RA: Endothelium, anesthetics, and vascular control. A nesthesiology 1993; 79: 1381–91Johns, RA
Nakamura K, Hatano Y, Toda H, Nishiwada M, Baek WY, Mori K: Halothane-induced relaxation of vascular smooth muscle: A possible contribution of increased cyclic GMP formation. Jpn J Pharmacol 1991; 55: 165–8Nakamura, K Hatano, Y Toda, H Nishiwada, M Baek, WY Mori, K
Eskinder H, Hillard CJ, Flynn N, Bosnjak ZP, Kampine JP: Role of guanylate cyclase-cGMP systems in halothane-induced vasodilation in canine cerebral arteries. A nesthesiology 1992; 77: 482–7Eskinder, H Hillard, CJ Flynn, N Bosnjak, ZP Kampine, JP
Hart JL, Jing M, Bina S, Freas W, Van Dyke RA, Muldoon SM: Effects of halothane on EDRF/cGMP-mediated vascular smooth muscle. A nesthesiology 1993; 79: 323–31Hart, JL Jing, M Bina, S Freas, W Van Dyke, RA Muldoon, SM
Scott-Burden T, Elizondo E, Ge T, Boulanger CM, Vanhoute PM: Simultaneous activation of adenylyl cyclase and protein kinase C induces production of nitric oxide by vascular smooth muscle cells. Mol Pharmacol 1994; 46: 274–82Scott-Burden, T Elizondo, E Ge, T Boulanger, CM Vanhoute, PM
Geng YJ, Wu Q, Hansson GK: Protein kinase C activation inhibits cytokine-induced nitric oxide synthesis in vascular smooth muscle cells. Biochim Biophys Acta 1994; 1223: 125–32Geng, YJ Wu, Q Hansson, GK
Hemmings HC Jr, Adamo AI: Effect of halothane on conventional protein kinase C translocation and down-regulation in rat cerebrocortical synaptosomes. Br J Anaesth 1997; 78: 189–96Hemmings, HC Adamo, AI
Zuo Z, Johns RA: Inhalational anesthetics up-regulate constitutive and lipopolysaccharide-induced inducible nitric oxide synthase expression and activity. Mol Pharmacol 1997; 52: 606–12Zuo, Z Johns, RA
Sirsjö A, Söderkvist P, Sundqvist T, Carlsson M, Öst M, Gidlöf A: Different induction mechanisms of mRNA for inducible nitric oxide synthase in rat smooth muscle cells in culture and in aortic strips. FEBS Lett 1994; 38: 191–6Sirsjö, A Söderkvist, P Sundqvist, T Carlsson, M Öst, M Gidlöf, A
Collart MA, Belin D, Vassalli JD, de Kossodo S, Vassalli P: Gamma interferon enhances macrophage transcription of tumor necrosis factor/cachectin, interleukin 1, and urokinase genes, which are controlled by short-lived repressors. J Exp Med 1986; 164: 2113–8Collart, MA Belin, D Vassalli, JD de Kossodo, S Vassalli, P
Eger EII: Isoflurane (Forane): A Compendium and Reference. Madison, Anaquest, 1986, pp 1–160
Hatano Y, Nakamura K, Yakushiji T, Nishiwada M, Mori K, Anaes FC: zComparison of the direct effects of halothane and isoflurane on large and small coronary arteries isolated from dogs. A nesthesiology 1990; 73: 513–7Hatano, Y Nakamura, K Yakushiji, T Nishiwada, M Mori, K Anaes, FC
Fig. 1. (A  ) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G  ) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P  < 0.01). EC50in the control group was less than that in the IL-1β group (P  < 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P  < 0.05). n = 7 rings each. (B  ) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P  < 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P  < 0.05). n = 7 rings each. For further details, see text.
Fig. 1. (A 
	) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J 
	), exposed to interleukin (IL)-1β (20 ng/ml, E 
	), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G 
	) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P 
	< 0.01). EC50in the control group was less than that in the IL-1β group (P 
	< 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P 
	< 0.05). n = 7 rings each. (B 
	) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P 
	< 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P 
	< 0.05). n = 7 rings each. For further details, see text.
Fig. 1. (A  ) Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings, which had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) and halothane (HAL, 3%) simultaneously (G  ) for 5 h. Maximum tension in the IL-1β groups was statistically less than that in control (P  < 0.01). EC50in the control group was less than that in the IL-1β group (P  < 0.01). EC50in the IL-1β plus HAL group was less than that in IL-1β (P  < 0.05). n = 7 rings each. (B  ) Modifications by HAL (1, 2, or 3%) of IL-1β–induced attenuation of the contractile response to PE. Maximum tension values in the IL-1β plus HAL (2%) groups and IL-1β plus HAL (1%) groups were 2,120 ± 284 and 2,059 ± 302 mg, respectively. EC50values in the IL-1β plus HAL (2%) group was less than that in IL-1β group (P  < 0.05). EC50in the IL-1β plus HAL (3%) group was less than that in the IL-1β plus HAL (1%) group (P  < 0.05). n = 7 rings each. For further details, see text.
×
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A  ), interleukin (IL)-1β (20 ng/ml) alone (B  ), HAL (1%) plus IL-1β (20 ng/ml) (C  ), HAL (2%) plus IL-1β (20 ng/ml) (D  ), and HAL (3%) plus IL-1β (20 ng/ml) (E  ) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A  ), IL-1β alone (B  ), HAL (1%) plus IL-1β (C  ), HAL (2%) plus IL-1β (D  ), and HAL (3%) plus IL-1β (E  ) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P  < 0.05 versus  IL-1β; †P  < 0.01 versus  control. n = 7 rings each. For further details, see text.
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A 
	), interleukin (IL)-1β (20 ng/ml) alone (B 
	), HAL (1%) plus IL-1β (20 ng/ml) (C 
	), HAL (2%) plus IL-1β (20 ng/ml) (D 
	), and HAL (3%) plus IL-1β (20 ng/ml) (E 
	) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A 
	), IL-1β alone (B 
	), HAL (1%) plus IL-1β (C 
	), HAL (2%) plus IL-1β (D 
	), and HAL (3%) plus IL-1β (E 
	) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P 
	< 0.05 versus 
	IL-1β; †P 
	< 0.01 versus 
	control. n = 7 rings each. For further details, see text.
Fig. 2. The second contractile response to KCl (30 mm) of aortic rings that had not been exposed (control), exposed to halothane (HAL; 3%) alone (A  ), interleukin (IL)-1β (20 ng/ml) alone (B  ), HAL (1%) plus IL-1β (20 ng/ml) (C  ), HAL (2%) plus IL-1β (20 ng/ml) (D  ), and HAL (3%) plus IL-1β (20 ng/ml) (E  ) for 5 h. Contraction induced by 30 mm KCl in the first trial was taken as 100%; mean values of contraction in control, HAL alone (A  ), IL-1β alone (B  ), HAL (1%) plus IL-1β (C  ), HAL (2%) plus IL-1β (D  ), and HAL (3%) plus IL-1β (E  ) were 1,587 ± 142, 1,503 ± 161, 1,632 ± 167, 1,548 ± 173, 1,749 ± 183, and 1,618 ± 159 mg, respectively. *P  < 0.05 versus  IL-1β; †P  < 0.01 versus  control. n = 7 rings each. For further details, see text.
×
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B  ) for 5 h. Contractions induced by PE (105m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J 
	), exposed to interleukin (IL)-1β (20 ng/ml, E 
	), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B 
	) for 5 h. Contractions induced by PE (10−5m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
Fig. 3. Cumulative concentration–response curves for phenylephrine (PE) in the second trial of aortic rings that had not been exposed (control, J  ), exposed to interleukin (IL)-1β (20 ng/ml, E  ), and exposed to IL-1β (20 ng/ml) plus isoflurane (ISO; 3%) simultaneously (B  ) for 5 h. Contractions induced by PE (105m) in the first trial were taken as 100%. n = 7 rings each. Control and IL-1β groups in this figure are the same as those shown in figure 1.
×
Fig. 4. (A  ) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P  < 0.01 versus  control; #P  < 0.01 versus  IL-1β; n = 6 strips each. (B  ) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C  ) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P  < 0.05 versus  control 5 h.
Fig. 4. (A 
	) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P 
	< 0.01 versus 
	control; #P 
	< 0.01 versus 
	IL-1β; n = 6 strips each. (B 
	) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C 
	) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P 
	< 0.05 versus 
	control 5 h.
Fig. 4. (A  ) Effects of interleukin (IL)-1β (20 ng/ml) or IL-1β (20 ng/ml) plus halothane (HAL; 3%) exposure on the tis- sue cyclic guanosine monophosphate (cGMP) contents. *P  < 0.01 versus  control; #P  < 0.01 versus  IL-1β; n = 6 strips each. (B  ) Effects of halothane (3%) exposure on the cGMP contents during the exposure period (1, 3, and 5 h; n = 6 strips each). (C  ) Effects of IL-1β (20 ng/ml), HAL (3%), or IL-1β (20 ng/ml) plus HAL (3%) exposure on the tissue cyclic adenosine monophosphate (cAMP) contents during the exposure period (1, 3, and 5 h; n = 6 strips each). #P  < 0.05 versus  control 5 h.
×
Fig. 5. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B  ) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 6 each. HAL = halothane.
Fig. 5. (A 
	) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B 
	) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P 
	< 0.01 versus 
	control; #P 
	< 0.05 versus 
	interleukin (IL)-1β; n = 6 each. HAL = halothane.
Fig. 5. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat induced nitric oxide synthase (iNOS). (B  ) Relative radioactivity of iNOS mRNA to ribosomal RNA, which were measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 6 each. HAL = halothane.
×
Fig. 6. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B  ) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 4 each. HAL = halothane.
Fig. 6. (A 
	) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B 
	) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P 
	< 0.01 versus 
	control; #P 
	< 0.05 versus 
	interleukin (IL)-1β; n = 4 each. HAL = halothane.
Fig. 6. (A  ) Northern blot hybridization using the synthesized cDNA probes for rat cyclooxygenase 2 (COX-2). (B  ) Relative radioactivity of COX-2 mRNA to β actin was measured by imaging analyzer (BAS 2000). *P  < 0.01 versus  control; #P  < 0.05 versus  interleukin (IL)-1β; n = 4 each. HAL = halothane.
×
Fig. 7. (A  ) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B  ) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P  < 0.05 versus  IL-1β; n = 4 each.
Fig. 7. (A 
	) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B 
	) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P 
	< 0.05 versus 
	IL-1β; n = 4 each.
Fig. 7. (A  ) Western blot analysis of cellular proteins in homogenates of rat aortic tissue with antiserum to induced nitric oxide synthase (iNOS). Lane 1, rat aortic tissue protein from control group; lane 2, protein from aortic tissue exposed to interleukin (IL)-1β (20 ng/ml) for 5 h; lane 3, exposed to IL-1β (20 ng/ml) plus halothane (HAL; 3%) for 5 h. Molecular markers are shown to the left. (B  ) Relative radioactivity of iNOS protein expression induced by IL-1β plus halothane to that induced by IL-1β was measured by imaging analyzer (BAS 2000). #P  < 0.05 versus  IL-1β; n = 4 each.
×