Free
Pain Medicine  |   June 2001
Divergence of Volatile Anesthetic Effects in Inhibitory Neurotransmitter Receptors
Author Affiliations & Notes
  • Eric P. Greenblatt, M.D.
    *
  • Xin Meng, M.D.
  • * Assistant Professor, † Research Technician.
  • Received from the Department of Anesthesia, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania.
Article Information
Pain Medicine
Pain Medicine   |   June 2001
Divergence of Volatile Anesthetic Effects in Inhibitory Neurotransmitter Receptors
Anesthesiology 6 2001, Vol.94, 1026-1033. doi:
Anesthesiology 6 2001, Vol.94, 1026-1033. doi:
THE molecular mechanism of volatile anesthetic (VA) action in the central nervous system remains controversial. Neurotransmitter receptor proteins are critical to the regulation of central nervous system excitability and are likely targets of VA action. VA effects may be explained, in part, by the ability to potentiate neuronal inhibition mediated by the neurotransmitters γ-aminobutyric acid (GABA) and glycine at GABA and glycine receptors, respectively. 1 
γ-Aminobutyric acid and glycine receptors are members of a superfamily of ligand-gated ion channels, which also include the nicotinic acetylcholine as well as serotonin type 3 receptors. 2 GABA and glycine receptors are members of a subfamily of these channel proteins that are selective for chloride ion. They are believed to exist as pentameric complexes formed by protein subunits; each subunit contains four putative transmembrane domains (M1–M4). 3 Within this subfamily are subgroups that show different sensitivities to VAs. Although most GABA type A (GABAA) receptors 4 and glycine receptors 5 are positively modulated at submaximal agonist concentrations, the ρ subtype of GABA receptors (sometimes referred to as GABAC) is insensitive or negatively modulated by these agents. 6 
Native GABAAreceptors exist in the mammalian central nervous system largely as heteromers of α, β, and γ subunits 7 with stoichiometry ααββγ, 8,9 but receptors expressed in vitro  using only α and β retain anesthetic modulation. 10 The native strychnine-sensitive glycine receptor is composed of α and β subunits, 11 but α subunits readily form homomeric receptors that retain agonist and antagonist 12 as well as anesthetic sensitivity. 13 GABA ρ receptors are believed to exist as homomers, and expression of the ρ subunit reconstitutes the pharmacology of the native receptor. 14 Since the primary amino acid structures of these receptors are known, their differences in VA sensitivity prompt the question whether structural motifs shared by glycine and GABAAas opposed to GABA ρ receptors, confer the pattern of VA modulation. To gain information about the molecular basis of these interactions, chimeric receptors were constructed by combining segments of positively modulated (GABAAor glycine) receptors with those from negatively modulated (GABA ρ1) receptors. Such a chimeric approach has been successfully applied to the characterization of other cell surface receptor proteins. Two-electrode voltage clamp was used to record currents from Xenopus  oocytes expressing chimeric receptors in the absence and presence of the VAs chloroform, enflurane, halothane, or isoflurane. It was hypothesized that the presence of specific portions of the native receptor proteins would be permissive for their respective anesthetic pharmacology. The pattern of modulation (i.e.  , whether VAs enhanced or inhibited responses) in chimeras would identify specific protein domains involved in the interaction of VAs with native receptors.
Materials and Methods
Preparation of Chimeras
The GABAAα2, glycine α1, and GABA ρ1receptor complementary DNA (cDNA) subunits were subcloned into the plasmid expression vector pRK7. A potential chimeric splice site, containing the invariant amino acid triplet proline alanine arginine, was identified at the 5′ end of the second transmembrane (M2) domain in all subunits (fig. 1). A silent mutation—a nucleotide substitution that does not alter amino acid sequence—was introduced into subunit cDNA clones to create a unique recognition site for the DNA restriction enzyme BssH  II. Site insertion was performed using a commercially available kit. Briefly, thermostable, high-fidelity, proofreading Pfu  DNA polymerase was used in the polymerase chain reaction to generate full-length nicked DNA products using primer oligonucleotides with the desired mutation and appropriate templates (Bam H  I-linearized constructs of each receptor cDNA in plasmid pRK7). Primers were designed and obtained for each subunit as follows: glycine α15′TGCTGCACCTGCGCGCGTGGGCCTAGGCA3′ (sense, nucleotides 825–853) and 5′TGCCTAGGCCCACGCGCGCAGGTGCAGCA3′ (antisense, nucleotides 825–853); GABA ρ15′CAGAGCCGTGCCTGCGCGCGTCCCCTTAGGTATC3′ (sense, nucleotides 921–954) and 5′GATACCTAAGGGGACGCGCGCAGGCACGGCTCTG3′ (antisense, nucleotides 921–954); GABAAα25′GAATCTGTGCCTGCGCGCACTGTGTTTGGAG3′ (sense, nucleotides 829–859) and 5′CTCCAAACACAGTGCGCGCAGGCACAGATTC3′ (antisense, nucleotides 829–859).
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH  II site was inserted in the M2 “PAR” box.
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH 
	II site was inserted in the M2 “PAR” box.
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH  II site was inserted in the M2 “PAR” box.
×
Polymerase chain reaction products were treated with Dpn  I endonuclease, which is specific for dam  -methylated DNA. Because DNA (including plasmid preparations) from virtually all Escherichia coli  strains is dam  -methylated and susceptible to Dpn  I digestion, this step removes any parental template DNA, selecting for mutation-containing newly synthesized DNA. Dpn  I–digested polymerase chain reaction products were used to transform E. coli  XL1-Blue competent cells to repair and replicate the mutant plasmid. Plasmid DNA was then prepared by large-scale culture of an appropriately antibiotic-resistant colony and purified by alkali lysis and CsCl gradient centrifugation. All mutants were partial-length DNA sequenced to verify splice regions. Dideoxy sequencing of double-stranded DNA and rescued single-stranded DNA was performed according to established protocols with minor variations. 15 
Mutant cDNA–plasmid constructs (fig. 2A) were digested with Nde  I and BssH  II (New England Biolabs, Inc., Beverly, MA) to obtain two restriction digest fragments (fig. 2B). The first fragment (1.6–1.9 kb) contained a 0.7-kb portion of the plasmid from its unique Nde  I site, extending up to and 0.9 kb into each subunit cDNA and ended at the newly introduced BssH  II site. The second, larger (4.8–5.2 kb) BssH  II–Nde  I fragment consisted of residual plasmid and insert. Fragments were isolated by gel electrophoresis, exchanged between pairs, and ligated to generate chimeric cDNAs (fig. 2C). All manipulations of DNA, including preparation of restriction digests and ligations, were performed according to the protocols of the manufacturer or according to commonly accepted procedures. 16 
Fig. 2. Schematic for production of chimeric cDNAs. (A  ) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde  I and BssH  II. 5′ and 3′ as defined in figure 1. (B  ) Fragments formed after digest with Nde  I and BssH  II. (C  ) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
Fig. 2. Schematic for production of chimeric cDNAs. (A 
	) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde 
	I and BssH 
	II. 5′ and 3′ as defined in figure 1. (B 
	) Fragments formed after digest with Nde 
	I and BssH 
	II. (C 
	) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
Fig. 2. Schematic for production of chimeric cDNAs. (A  ) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde  I and BssH  II. 5′ and 3′ as defined in figure 1. (B  ) Fragments formed after digest with Nde  I and BssH  II. (C  ) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
×
Expression of Chimeras
Chimera complementary RNAs (cRNAs) were generated in vitro  . Phage polymerase SP6 was used to make full-length capped RNA transcripts from BamH  I–linearized chimera template DNA using a commercial kit according to the manufacturer’s protocol.
Adult female Xenopus laevis  frogs were purchased from Nasco (Fort Atkinson, WI). Oocytes were obtained from frogs according to a protocol approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania and consistent with National Institutes of Health and American Physiological Society guidelines. Frogs were anesthetized by immersion in 0.2% iced 3-aminobenzoic acid ethyl ester methanesulfonate salt. An incision was made in the abdominal wall, and a small piece of ovary was excised and manually dissected to free oocytes from surrounding tissue. After removal of the oocyte follicular layer by collagenase incubation in OR2 solution (82.5 mm NaCl, 2 mm KCl, 1 mm MgCl2, 5 mm HEPES, pH 7.5), oocytes were washed and placed in ND96 medium (96 mm NaCl, 2 mm KCl, 1 mm MgCl2, 1.8 mm CaCl2, 5 mm HEPES, 5 mm pyruvate, pH 7.5). Stage V–VI oocytes 17 were injected in the vegetal pole with cRNA (50 nl; 10–25 ng of cRNA transcript suspended in diethyl pyrocarbonate–treated water) using a digital microdispenser. Given that the wild-type GABAAα2subunit does not form functional homomeric receptors, 18,19 a subset of the oocytes injected with chimeras containing sequences from GABAAα2were co-injected with wild-type GABAAβ1subunit cRNAs to facilitate heteromeric receptor expression. Oocytes were maintained at 18°C in ND96 solution with antibiotic (50 μg/ml gentamicin) for 2–6 days before use in experiments.
Electrophysiologic Recording
Agonist-evoked currents were measured using a two-electrode voltage clamp amplifier. For recording, oocytes were positioned in a small chamber (approximately 100-μL volume) and continuously superfused (5 ml/min) with ND96 buffer solution. Oocytes were impaled with borosilicate glass microelectrodes filled with 3 m KCl (typical resistance, 0.5–3 MΩ). Currents were low-pass filtered and digitized using an A/D interface with chart recording software and stored on a computer hard disk.
Chimera-injected oocytes were screened for agonist (GABA or glycine) specificity. Dose–response studies (GABA, 0.1 μm to 10 mm; or glycine, 1 μm to 100 mm) established agonist sensitivity of each construct. Peak oocyte currents evoked by EC10(that which evoked 10% of the maximal current response) for the appropriate agonist were measured in the absence and presence of 1.2 mm chloroform, 0.75 mm enflurane, 0.3 mm halothane, or 0.4 mm isoflurane at 25°C. These anesthetic concentrations each approximate 1.5 times the minimum alveolar concentration (MAC) for humans, 20 with the exception of chloroform, for which the concentration was estimated from published MAC values for dogs. 21 Small agonist doses were used to increase sensitivity for detecting VA modulation, since VA effects are most prominent in this agonist range. 1 
All drugs were dissolved in buffer and applied by gravity-fed superfusion. VAs were applied to the preparation via  the extracellular medium. Each VA was preapplied 5 min to assure equilibration. Anesthetic solutions were prepared by addition of liquid phase anesthetic to medium in airtight containers (plastic intravenous solution bags) that were vortexed (1 min) and stirred to allow equilibration (30 min). Appropriate volumes of liquid anesthetic were calculated using published MAC values, solubility coefficients, and temperature coefficients of solubility. 20 Experiments were repeated on at least four individual oocytes. Anesthetic concentrations in the assay chamber were verified by gas chromatography of aliquots removed during experiments; gas-tight Hamilton syringes were used, and aliquots were immediately deposited in airtight septum-capped vials. VA concentrations sampled from the oocyte bath remained at or above 90% of the applied drug level.
Halothane was obtained from Halocarbon Laboratories (River Edge, NJ), and isoflurane was obtained from Anaquest (Madison, WI). All other chemicals were obtained from Sigma (St. Louis, MO).
Statistical Analysis
Data were normalized for each oocyte to eliminate variation in control currents caused by receptor expression. Mean peak currents were analyzed with curve-fitting software to establish EC10, EC50, and Hill coefficients for each chimera.
Data from anesthetic experiments were expressed as mean ± SD percent change from control current and were analyzed by unpaired Student t  test. P  < 0.05 was considered significant.
Results
Chimera Nomenclature
Chimeric constructs (fig. 3) were designated as follows. The chimera with glycine α1sequence extending from its N-terminus to the M2 splice site, and the remaining sequence from the splice to C-terminus contributed by GABA ρ1, was designated glyrho. The chimera with sequence from N-terminus to splice contributed by GABA ρ1, and the remainder from glycine α1, was designated rhogly. The chimera with GABAAα2sequence from N-terminus to the splice and the remainder from GABA ρ1was designated α2rho. The chimera with GABA ρ1sequence from N-terminus to splice, and the remainder from GABAAα2, was designated rhoα2.
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A  ) glyrho and rhogly; (B  ) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH  II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A 
	) glyrho and rhogly; (B 
	) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH 
	II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A  ) glyrho and rhogly; (B  ) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH  II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
×
Responses of Chimeric Receptors to Agonists
The agonist pharmacology of chimeras expressed in Xenopus  oocytes is summarized in table 1. The glyrho construct showed specificity for glycine, while the rhogly and rhoα2constructs each showed specificity for GABA. Co-injection of wild-type GABAAβ1did not appear to alter rhoα2responses. Oocytes injected with α2rho (irrespective of whether wild-type GABAAβ1was co-injected) showed no response at GABA up to 1 × 102. Dose–response curves for expressed chimeras are shown in figures 4A–C.
Table 1. Agonist Pharmacology of Chimeras Expressed in Xenopus Oocytes
Image not available
Table 1. Agonist Pharmacology of Chimeras Expressed in Xenopus Oocytes
×
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus  oocytes. Data are normalized mean ± SEM of peak currents. (A  ) glyrho; (B  ) rhogly; (C  ) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus 
	oocytes. Data are normalized mean ± SEM of peak currents. (A 
	) glyrho; (B 
	) rhogly; (C 
	) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus  oocytes. Data are normalized mean ± SEM of peak currents. (A  ) glyrho; (B  ) rhogly; (C  ) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
×
Volatile Anesthetic Modulation of Chimeric Receptors
Coapplication of VAs altered control responses to agonists. Representative oocyte recordings are shown in figures 5A–C. Effects of VAs are depicted graphically in figure 5D. Glycine-evoked currents in glyrho receptors were inhibited by enflurane (−10 ± 2.0%; n = 4) or isoflurane (−17.7 ± 4.4%; n = 6) but were enhanced by chloroform (12 ± 9.6%; n = 5) or halothane (15 ± 4.2%; n = 5). GABA-evoked currents in rhogly receptors were enhanced by enflurane (11.8 ± 5.8%; n = 4) or isoflurane (16 ± 6.6%; n = 4) but were inhibited by chloroform (−11 ± 7.6%; n = 4) or halothane (−14 ± 6.0%; n = 5). Currents in oocytes expressing rhoα2were inhibited by chloroform (−15 ± 10.5%; n = 5) or halothane (−20 ± 6.8%; n = 4) but were enhanced by enflurane (24 ± 11.6%; n = 4) or isoflurane (30 ± 11.6%; n = 6). All VA effects were significant versus  control (P  < 0.05).
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Clcurrents in Xenopus  oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A  ) glyrho, (B  ) rhogly, and (C  ) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D  ) Summary data (mean ± SD) for effects of VAs on chimeras.
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Cl−currents in Xenopus 
	oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A 
	) glyrho, (B 
	) rhogly, and (C 
	) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D 
	) Summary data (mean ± SD) for effects of VAs on chimeras.
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Clcurrents in Xenopus  oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A  ) glyrho, (B  ) rhogly, and (C  ) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D  ) Summary data (mean ± SD) for effects of VAs on chimeras.
×
To explore the dependence of these effects on VA concentration, a set of additional experiments were performed with the chimera glyrho. Three concentrations of VA approximating 1, 2, and 3 MAC (0.2 0.4, and 0.6 mm halothane or 0.3, 0.6, and 1.0 mm isoflurane, respectively) were co-applied with GABA EC10. Isoflurane inhibited currents in oocytes expressing this chimera at all concentrations except the highest, whereas halothane enhancement of currents was observed only at 1.5 or 2 MAC. These results are summarized in table 2.
Table 2. Effect of VA Concentration on GABA-gated Currents in Xenopus Oocytes Expressing Chimera Glyrho
Image not available
Table 2. Effect of VA Concentration on GABA-gated Currents in Xenopus Oocytes Expressing Chimera Glyrho
×
Discussion
The agonist selectivity of our chimeras, formed from native receptors with dissimilar agonists, were consistent with existing data that agonist binding domains for GABA and glycine receptors are found in the large 5′ extracellular regions. 22,23 Yet our chimeras showed variance in agonist sensitivity when compared with wild-type receptors. The sensitivity of chimera rhogly to GABA is approximately 10-fold greater than wild-type ρ11EC50is 1.5 μm GABA in Xenopus  oocytes; data not shown). The chimera rhoα2showed approximately 100-fold less GABA sensitivity than ρ1. The chimera glyrho was approximately 100-fold less sensitive to glycine compared with wild-type glycine α1, but within the range of apparent agonist affinity observed among all known glycine α subunit isoforms. 24 Whether such changes reflect alterations in the agonist binding equilibrium or changes in efficacy of the transduction mechanism for channel gating cannot be determined from these data. Rhogly and rhoα2showed qualitatively similar responses to VAs despite different agonist sensitivities. Therefore, such differences in agonist sensitivity may not be important to the VA effects demonstrated here.
The failure to detect functional receptors in oocytes injected with α2rho may result from one or more possible occurrences, including disruption of assembly or posttranslational processing, assembly with failure to insert properly in the cell membrane, or assembly with cell surface expression but loss of function. The extracellular domains of ligand-gated ion channels are crucial for assembly of functional receptors. 11 The extracellular domains of chimera α2rho were contributed by a GABAAα subunit, which does not form functional homomeric receptors, 18,19 possibly accounting for the observed lack of expression. In contrast, the rhoα2chimera, which has an extracellular component from the “homomer-native” GABA ρ, did form functional homomeric receptors. To facilitate possible assembly of an α2rho–GABAAβ heteromeric receptor, GABAAβ subunit cRNAs were co-injected with α2rho. The fact that this heteromer strategy was also unsuccessful suggests that the chimera α2rho, even if translated, most likely had sufficient distortion of its tertiary structure as to also preclude effective interaction with the β subunit. In an attempt to distinguish between failed assembly and assembly–surface expression without function, limited studies using radioligand binding of [3H]-muscimol (a GABA agonist) were performed. Binding studies failed to detect any specific binding of either homomer or heteromer combination (data not shown). However, this result cannot distinguish between lack of surface expression and altered affinity for the radioligand. These results are consistent with previously published data showing inability to achieve expression of chimeric GABA–glycine receptors with large 5′ domains, which include M1 contributed by GABAAreceptors. 25 
In oocytes expressing chimeric receptors constructed for this study, two patterns of VA modulation were observed. The pattern of chloroform or halothane modulation for all expressed chimeras resembled that observed in the whole native receptor, which had contributed the portion of the receptor 5′ to the splice point. Thus, when GABA ρ contributed the 5′ portion (as in chimera rhogly or rhoα2), the resultant chimera showed negative modulation by halothane or chloroform, like wild-type GABA ρ. When a glycine receptor subunit donated the 5′ portion (as in chimera glyrho), chloroform or halothane positively modulated agonist gating, as they would in the wild-type glycine receptor. In contrast, isoflurane or enflurane influences on chimeras uniformly resembled those observed in the portion of the receptor 3′ to the splice. If GABA ρ contributed the 3′ portion (chimera glyrho), the resultant chimera showed negative modulation by enflurane or isoflurane, like the wild-type GABA ρ. However, if a glycine or GABAAreceptor contributed the 3′ portion (chimera rhogly or rhoα2), the resultant chimera showed positive modulation by enflurane or isoflurane, like the wild-type “parents.”
Our results suggest that the VAs studied here fall into two groups that appear to have different molecular interactions with this family of receptors. To the best of our knowledge, these are the first data demonstrating functional divergence of VA action on a single protein target.
The magnitude of negative modulation of these chimeras by VAs was consistent with that reported for GABA ρ wild-type, since previous studies of VA effects on GABA ρ were performed at approximately twice the concentrations of VA that were used here. 6 The magnitude of positive modulation by VAs was less pronounced with our chimeras than the twofold to threefold potentiation of agonist responses previously reported in wild-type recombinant GABAA1 or glycine 13 receptors. Because the direction of modulation (i.e.  , whether positive or negative) for individual VAs was consistent for each chimera in numerous oocytes tested, our results are important in the pursuit of the mechanism of VA actions in native receptors. Chimeras with components from “parent” receptors whose pharmacology is as different as those used here can be expected to show complex responses. Indeed, our chimeric receptors do not reproduce perfectly the pharmacology of their native components.
In experiments on chimera glyrho where VA concentration was varied from one to three times MAC, the magnitude of VA effects appeared to be greater at the lowest range of concentrations, although one cannot determine from these data a precise VA dose–response pattern. However, the pattern of modulation was generally consistent with that observed at 1.5 MAC (i.e.  , isoflurane inhibited this receptor, whereas halothane enhanced), suggesting that the 1.5-MAC data for this chimera can be viewed as representative. Variance of these responses from those observed with wild-type receptors is, as previously discussed, to be expected.
Our results are in agreement with reports that have identified two residues in M2 and M3, respectively (both found in the 3′ domains of the chimeras used here), which are critical for the action of enflurane 26 or isoflurane 27 in GABAAand glycine receptors. These results are in apparent conflict with a study 28 using a nicotinic acetylcholine–serotonin receptor, in which nicotinic acetylcholine subunit α7contributed the extracellular N-terminal, and serotonin-3Athe transmembrane and C-terminal domains. Halothane or isoflurane inhibited responses in that chimera, leading the investigators to conclude that the extracellular N-terminal domain was critical for action of these VAs. This discrepancy may be attributable, in part, to their use of isoflurane and halothane concentrations (> 10 MAC) far in excess of the clinically relevant concentrations used here. It is well known that high VA concentrations can inhibit agonist-evoked currents in GABA or glycine receptors.
The VAs studied here can also be cosegregated into the same grouping based on chemical properties. Halothane and chloroform are halogen-substituted alkanes, where-as isoflurane and enflurane are halogenated methy-ethyl ether derivatives. It has long been a matter of controversy how the mechanism of general anesthesia could involve chemically distinct anesthetic compounds that apparently exert similar end effects on a putative molecular target. To explain the discrepancy between these results and the observation that all of these VAs can positively modulate these receptors, we suggest the following hypothesis. Rather than hosting a unitary molecular site for interaction with all VAs, a single protein may show multiple target domains, each of which possesses chemical attributes favoring interaction with a particular subgroup of anesthetics. It is beyond the scope of this study to determine the specific chemical properties that underlie the divergent effects observed here. Additional evidence supports the concept of segregation of chemically related groups of VAs to divergent central nervous system target sites. Specific binding sites on nicotinic acetylcholine receptors can discriminate between halothane and isoflurane in competitive assays using photoaffinity labels. 29 The existence of mutant strains of the nematode Caenorhabditis elegans  , which are divergent for isoflurane versus  halothane stereoselectivity, may also be interpreted as evidence that these VAs may each have a different site of action. 30 
In summary, our results show, for the first time, a divergence in VA interactions with chimeric GABA–glycine receptors. The halogenated alkane VAs studied here (chloroform or halothane) had a consistent pattern of modulation that appeared to depend on the identity of the native receptor donating the portion of the chimera that included the N-terminal extracellular domain and M1. Conversely, the substituted ether VAs (enflurane or isoflurane) showed a pattern of modulation that was dependent on the identity of the native receptor contributing the portion that included M2–M4 and the C-terminus. If these divergent effects can be extrapolated to the native receptor proteins, it suggests that different groups of VAs may interact with disparate functional domains within a single protein. Although there can be no identification of the actual molecular site of VA action in any relevant protein target until detailed ultrastructural information becomes available, our results support the view that highly specific interactions between VAs and proteins underlie the anesthetic effect.
This work is dedicated to the memory of the late Dolan B. Pritchett, Ph.D. (Department of Pharmacology and Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania), who provided invaluable inspiration and guidance.
References
Harris RA, Mihic SJ, Dildy-Mayfield JE, Machu TK: Actions of anesthetics on ligand-gated ion channels: Role of receptor subunit composition. FASEB J 1995; 9: 1454–62Harris, RA Mihic, SJ Dildy-Mayfield, JE Machu, TK
Ortells MO, Lunt GG: Evolutionary history of the ligand-gated ion-channel superfamily of receptors. Trends Neurosci 1995; 18: 121–7Ortells, MO Lunt, GG
Whiting PJ, McKernan RM, Wafford KA: Structure and pharmacology of vertebrate GABAAreceptor subtypes. Int Rev Neurobiol 1995; 38: 95–138Whiting, PJ McKernan, RM Wafford, KA
Tanelian DL, Kosek P, Mody I, MacIver MB: The role of the GABAAreceptor/chloride channel complex in anesthesia. A nesthesiology 1993; 78: 757–76Tanelian, DL Kosek, P Mody, I MacIver, MB
Downie DL, Hall AC, Lieb WR, Franks NP: Effects of inhalational general anaesthetics on native glycine receptors in rat medullary neurones and recombinant glycine receptors in Xenopus oocytes. Br J Pharmacol 1996; 118: 493–502Downie, DL Hall, AC Lieb, WR Franks, NP
Mihic SJ, Harris RA: Inhibition of ρ1receptor GABAergic currents by alcohols and volatile anesthetics. J Pharmacol Exp Ther 1996; 277: 411–6Mihic, SJ Harris, RA
McKernan RM, Whiting PJ: Which GABAA-receptor subtypes really occur in the brain? Trends Neurosci 1996; 19: 139–43McKernan, RM Whiting, PJ
Chang Y, Wang R, Barot S, Weiss DS: Stoichiometry of a recombinant GABAAreceptor. J Neurosci 1996; 16: 5415–24Chang, Y Wang, R Barot, S Weiss, DS
Tretter V, Ehya N, Fuchs K, Sieghart W: Stoichiometry and assembly of a recombinant GABAAreceptor subtype. J Neurosci 1997; 17: 2728–37Tretter, V Ehya, N Fuchs, K Sieghart, W
Harrison NL, Kugler JL, Jones MV, Greenblatt EP, Pritchett DB: Positive modulation of human gamma-aminobutyric acid type A and glycine receptors by the inhalation anesthetic isoflurane. Mol Pharmacol 1993; 44: 628–32Harrison, NL Kugler, JL Jones, MV Greenblatt, EP Pritchett, DB
Betz H, Kuhse J, Schmieden V, Laube B, Kirsch J, Harvey RJ: Structure and functions of inhibitory and excitatory glycine receptors. Ann NY Acad Sci 1999; 868: 667–76Betz, H Kuhse, J Schmieden, V Laube, B Kirsch, J Harvey, RJ
Vandenberg RJ, Handford CA, Schofield PR: Distinct agonist- and antagonist-binding sites on the glycine receptor. Neuron 1992; 9: 491–6Vandenberg, RJ Handford, CA Schofield, PR
Mascia MP, Machu TK, Harris RA: Enhancement of homomeric glycine receptor function by long-chain alcohols and anaesthetics. Br J Pharmacol 1996; 119: 1331–6Mascia, MP Machu, TK Harris, RA
Cutting GR, Lu L, O’Hara BF, Kasch LM, Montrose-Rafizadeh C, Donovan DM, Shimada S, Antonarakis SE, Guggino WB, Uhl GR, Kazazian HH Jr: Cloning of the gamma-aminobutyric acid (GABA) ρ1cDNA: A GABA receptor subunit highly expressed in the retina. Proc Natl Acad Sci U S A 1991; 88: 2673–7Cutting, GR Lu, L O’Hara, BF Kasch, LM Montrose-Rafizadeh, C Donovan, DM Shimada, S Antonarakis, SE Guggino, WB Uhl, GR Kazazian, HH
Pritchett DB, Sontheimer H, Shivers BD, Ymer S, Kettenmann H, Schofield PR, Seeburg PH: Importance of a novel GABAAreceptor subunit for benzodiazepine pharmacology. Nature 1989; 338: 582–5Pritchett, DB Sontheimer, H Shivers, BD Ymer, S Kettenmann, H Schofield, PR Seeburg, PH
Bloch KD, Struhl K: Enzymatic manipulation of DNA and RNA, Current Protocols in Molecular Biology, 2nd Edition. Edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. New York, John Wiley & Sons, 1998, pp 3.1.1–3.16.11
Dumont JN: Oogenesis in Xenopus laevis (Daudin). I. Stages of oocyte development in laboratory maintained animals. J Morphol 1972; 136: 153–79Dumont, JN
Angelotti TP, Macdonald RL: Assembly of GABAAreceptor subunits: Alpha 1 beta 1 and alpha 1 beta 1 gamma 2S subunits produce unique ion channels with dissimilar single-channel properties. J Neurosci 1993; 13: 1429–40Angelotti, TP Macdonald, RL
Verdoorn TA, Draguhn A, Ymer S, Seeburg PH, Sakmann B: Functional properties of recombinant rat GABAAreceptors depend upon subunit composition. Neuron 1990; 4: 919–28Verdoorn, TA Draguhn, A Ymer, S Seeburg, PH Sakmann, B
Franks NP, Lieb WR: Temperature dependence of the potency of volatile general anesthetics: Implications for in vitro experiments. A nesthesiology 1996; 84: 716–20Franks, NP Lieb, WR
Eger EI 2nd, Lundgren C, Miller SL, Stevens WC: Anesthetic potencies of sulfur hexafluoride, carbon tetrafluoride, chloroform and Ethrane in dogs: Correlation with the hydrate and lipid theories of anesthetic action. A nesthesiology 1969; 30: 129–35Eger, EI Lundgren, C Miller, SL Stevens, WC
Rajendra S, Vandenberg RJ, Pierce KD, Cunningham AM, French PW, Barry PH, Schofield PR: The unique extracellular disulfide loop of the glycine receptor is a principal ligand binding element. EMBO J 1995; 14: 2987–98Rajendra, S Vandenberg, RJ Pierce, KD Cunningham, AM French, PW Barry, PH Schofield, PR
Smith GB, Olsen RW: Functional domains of GABAAreceptors. Trends Pharmacol Sci 1995; 16: 162–8Smith, GB Olsen, RW
Grenningloh G, Schmieden V, Schofield PR, Seeburg PH, Siddique T, Mohandas TK, Becker CM, Betz H: Alpha subunit variants of the human glycine receptor: Primary structures, functional expression and chromosomal localization of the corresponding genes. EMBO J 1990; 9: 771–6Grenningloh, G Schmieden, V Schofield, PR Seeburg, PH Siddique, T Mohandas, TK Becker, CM Betz, H
Koltchine VV, Ye Q, Finn SE, Harrison NL: Chimeric GABAA/glycine receptors: Expression and barbiturate pharmacology. Neuropharmacology 1996; 35: 1445–56Koltchine, VV Ye, Q Finn, SE Harrison, NL
Mihic SJ, Ye Q, Wick MJ, Koltchine VV, Krasowski MD, Finn SE, Mascia MP, Valenzuela CF, Hanson KK, Greenblatt EP, Harris RA, Harrison NL: Sites of alcohol and volatile anaesthetic action on GABAAand glycine receptors. Nature 1997; 389: 385–9Mihic, SJ Ye, Q Wick, MJ Koltchine, VV Krasowski, MD Finn, SE Mascia, MP Valenzuela, CF Hanson, KK Greenblatt, EP Harris, RA Harrison, NL
Krasowski MD, Koltchine VV, Rick CE, Ye Q, Finn SE, Harrison NL: Propofol and other intravenous anesthetics have sites of action on the gamma-aminobutyric acid type A receptor distinct from that for isoflurane. Mol Pharmacol 1998; 53: 530–8Krasowski, MD Koltchine, VV Rick, CE Ye, Q Finn, SE Harrison, NL
Zhang L, Oz M, Stewart RR, Peoples RW, Weight FF: Volatile general anaesthetic actions on recombinant nACh alpha 7, 5-HT3 and chimeric nACh alpha 7-5-HT3 receptors expressed in Xenopus oocytes. Br J Pharmacol 1997; 120: 353–5Zhang, L Oz, M Stewart, RR Peoples, RW Weight, FF
Eckenhoff RG: An inhalational anesthetic binding domain in the nicotinic acetylcholine receptor. Proc Natl Acad Sci U S A 1996; 93: 2807–10Eckenhoff, RG
Morgan PG, Usiak MF, Sedensky MM: Genetic differences affecting the potency of stereoisomers of isoflurane. A nesthesiology 1996; 85: 385–92Morgan, PG Usiak, MF Sedensky, MM
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH  II site was inserted in the M2 “PAR” box.
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH 
	II site was inserted in the M2 “PAR” box.
Fig. 1. Partial sequence amino acid alignment of wild-type GABAAα2, glycine α1, and GABA ρ1subunits. 5′ and 3′ indicate orientation toward to N-terminus and C-terminus, respectively. M1 and M2 regions are indicated by dark overline. Sequence identity among subunits is indicated by “boxed” residues. A BssH  II site was inserted in the M2 “PAR” box.
×
Fig. 2. Schematic for production of chimeric cDNAs. (A  ) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde  I and BssH  II. 5′ and 3′ as defined in figure 1. (B  ) Fragments formed after digest with Nde  I and BssH  II. (C  ) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
Fig. 2. Schematic for production of chimeric cDNAs. (A 
	) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde 
	I and BssH 
	II. 5′ and 3′ as defined in figure 1. (B 
	) Fragments formed after digest with Nde 
	I and BssH 
	II. (C 
	) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
Fig. 2. Schematic for production of chimeric cDNAs. (A  ) Wild-type receptor cDNAs (GABA ρ1, dark gray; glycine α1, striped) in plasmid (pRK7, light gray). Note restriction enzyme recognition sites for Nde  I and BssH  II. 5′ and 3′ as defined in figure 1. (B  ) Fragments formed after digest with Nde  I and BssH  II. (C  ) Exchange of smaller fragments and ligation to generate two chimeric cDNAs.
×
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A  ) glyrho and rhogly; (B  ) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH  II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A 
	) glyrho and rhogly; (B 
	) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH 
	II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
Fig. 3. Chimeric receptor constructs indicating relative contributions from wild-type receptor subunits. (A  ) glyrho and rhogly; (B  ) α2rho and rhoα2. M1–M4 indicate transmembrane domains. Note BssH  II restriction enzyme recognition site in M2, which forms splice site. 5′ and 3′ as defined in figure 1.
×
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus  oocytes. Data are normalized mean ± SEM of peak currents. (A  ) glyrho; (B  ) rhogly; (C  ) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus 
	oocytes. Data are normalized mean ± SEM of peak currents. (A 
	) glyrho; (B 
	) rhogly; (C 
	) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
Fig. 4. Agonist dose–response curves for chimeras expressed in Xenopus  oocytes. Data are normalized mean ± SEM of peak currents. (A  ) glyrho; (B  ) rhogly; (C  ) rhoα2alone (closed boxes, solid line) and rhoα2co-injected with wild-type GABAAβ1(open triangles, dashed line). See table 1for specific fitted parameters.
×
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Clcurrents in Xenopus  oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A  ) glyrho, (B  ) rhogly, and (C  ) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D  ) Summary data (mean ± SD) for effects of VAs on chimeras.
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Cl−currents in Xenopus 
	oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A 
	) glyrho, (B 
	) rhogly, and (C 
	) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D 
	) Summary data (mean ± SD) for effects of VAs on chimeras.
Fig. 5. Effects of volatile anesthetics (VAs) on agonist-evoked Clcurrents in Xenopus  oocytes expressing chimeric cRNAs. Representative traces from single oocytes expressing chimera (A  ) glyrho, (B  ) rhogly, and (C  ) rhoα2. Bars indicate duration of coapplication of anesthetics with EC10for appropriate agonist. ENF = enflurane; ISO = isoflurane; CHL = chloroform; HAL = halothane. (D  ) Summary data (mean ± SD) for effects of VAs on chimeras.
×
Table 1. Agonist Pharmacology of Chimeras Expressed in Xenopus Oocytes
Image not available
Table 1. Agonist Pharmacology of Chimeras Expressed in Xenopus Oocytes
×
Table 2. Effect of VA Concentration on GABA-gated Currents in Xenopus Oocytes Expressing Chimera Glyrho
Image not available
Table 2. Effect of VA Concentration on GABA-gated Currents in Xenopus Oocytes Expressing Chimera Glyrho
×